Title: Whale of a Tale: Solving Mysteries of Declining Whale Populations
1Whale of a TaleSolving Mysteries of Declining
Whale Populations
Name this whale. Hint Globicephala melas
2Whats the problem?
- International moratorium on whaling 1986
- Certain species did not rebound.
- Develop your own hypothesis.
3A Few Whales and Their Statuses
Data from International Union for Conservation
of Nature, 2004
4Scott Bakers Hypothesis
- Baker feels the protected whales are still being
hunted by Japanese Fishermen. - How would you collect data to back up this
hypothesis?
5What is Bioinformatics??
- Biological Data
- Computers
- Statistics
- Information Science
- Internet
6Biological Data
- Lots of data!
- DNA Sequences
- RNA
- Protein Sequences
- Protein Structures
7Computers and Bioinformatics to
- Store Data
- Retrieve Data
- Analyze Data
- Many Tools on Internet, for free
- Solve biological problems
8What does a Bioinformatics tool look like and how
can it be used?
9Bioinformatics to Examine Catches from Japanese
Fish Markets
- Scott Baker-Sampled 655 Whale Products in
Japanese Fish Markets, 1997-2002 - Sequenced DNAs of Samples
- Witness for the Whales
-
- Whale, dolphin, and porpoise DNA sequences
submitted into database
10Lab Analysis Sequence of __.
Unknown1 GAAAATATATATTGTACAATAACCACAAGGCCACAGTATTA
TGTCCGTATTAAAAATAACTTATTTTATTGCATACTGTTATGTAACTTGT
GCATGTATGTACTCCCACATAACCCATAGTAGTTAGTATTCCCCTGTGAA
TATGTATATGTACACATACTATGTATAATTGTGCATTCAATTATCTTCAC
TACGGAAGTTAAAGCCCGTATTAAATTTTATTAATTTTACATATTACATA
ATATTTATTAATAGTACAATAGTACATGTTCTTATGCATCCTCAGGTCAT
TCTAGACGGAATGACTCTTATGGCCGCTCCATTAGATCACGAGCTTAATC
AGCATGCCGCGTGAAACCAGCAACCCGCTCGGCAGGGATCCCTCTTCTCG
CACCGGGCCCATCAATCGTGGGGGTAGCTATTTAATGATCTTTATAAGAC
ATCTGGTTCTTACTTCAGGACCATATTAACTTAAAATCGCCCACTC
11BLAST Basic Local Alignment Search Tool
- http//www.ncbi.nlm.nih.gov/BLAST/
- Compares nucleotide or protein sequences against
others submitted into database - Useful in identifying an unknown sequence or
finding closely related sequences
12BLAST Applications
- With a DNA sequence, you could
- find out the species.
- determine the gene location (if known).
- find the corresponding amino acids.
- determine protein shape function.
- diagnose possible mutations.
- compare to other species for molecular
relatedness. - do much, much, more!
13Most of Whale Meat Legal But
- Grey Whale--illegal
- 10 of Samples Illegal
- 10 of Samples Sheep and Horse!
- Bioinformatic Tools for Tracking Species,
Conservation, Ecology, and Environment
14Results (cont.)
- These results confirmed the power of molecular
methods for monitoring retail markets and pointed
to the inadequacy of the current moratorium for
insuring the recovery of protected species. More
importantly, the integration of genetic evidence
with a model of population dynamics identified an
urgent need for actions to limit undocumented
exploitation of a 'protected' stock of whales .
Predicted Decline of protected whales based on
molecular genetic monitoring of Japanese and
Korean markets PROC. ROY. SOC. LOND. B, VOL 267,
NO. 1149, 22 JUNE 2000.C.S. Baker, G.M. Lento,
F. Cipriano and S.R. Palumbi
15Meet Scott Baker
16(No Transcript)