Title: Better Living through Biochemistry Enhanced Diffusive Flux as a Measure of Bioavailable Aquatic Iron
1Better Living Through Biochemistry
Enhanced Diffusive Flux
as a Measure of
Bioavailable Aquatic Iron Concentration
By Brian Gaas
2On the Menu
- Project Summary
- Justification
- Background
- Fe chemistry
- Biological Fe uptake
- Diffusive flux model
- Objectives
- Methods
- Genetic modification
- 55Fe uptake
- Flux calculation
- Conclusion
D.F.
55Fe
T.w.
3Project Summary
- Determination of bioavailable Fe in marine
systems - Based on diffusion rate from medium to cell
surface as function of concentration gradient
Q (D/l) (Cs Cm)
55Fe uptake
Hydrodynamic modeling
Genetic engineering
The Unknown
- Just add seawater and voila! Instant
bioavailable Fe concentrations!
4Who Ordered This?
- Iron (Fe) micronutrient, capable of limiting
community plankton growth in HNLC regions - Assays exist to determine total Fe concentration,
speciation, and potential Fe limitation - But, populations can differ in relation to Fe
quotas - To measure the amount of bioavailable Fe,
irrespective of the Fe demand of the organism, a
different method must be employed.
5Place Settings Fe Chemistry
- Biological, physical and chemical processes all
affect Fe biogeochemistry and speciation - Almost all dissolved Fe is Fe (III)
- Fe(OH)x at surface ocean pH (8.2) and surface
temperature (25C) - Fe(OH)2 and Fe(OH)30
- Many confounding factors to determining Fe
concentration - Filter size
- Oxidation state change
- Fe hydroxide precipitation Fe(OH)x, Fe(OOH),
Fe2O3 - Temperature, pH, light
- Organic complexes! 99.9 total Fe (III)
6Marinobactin siderophore (peptide-based)
Hydroxamate siderophore (ferrichrome)
Humic acid
7Place Settings Biological Use
- Fe deficiencies and excesses can limit
phytoplankton growth - Not all forms of Fe are available for uptake
- Fe (III) Fe(OH)x
- Colloidal iron has no direct biological use
- Not all Fe is taken up
- Internal Fe requirement
- Surface-bound transporters
- Siderophores
- Phytotransferrin
- Michaelis-Menten equation describe Fe uptake
kinetics
8Place Settings Flux Model
- Maximum diffusion 8 mean cell radius
- QR 4pR2JR 14.4pRD(?C)
- QR rate of transport to the cell
- JR nutrient flux at cell surface
- R mean cell radius
- D diffusivity constant
- ?C concentration difference between medium and
cell surface - Non-spherical shape of a centric diatom does not
change the calculations significantly
9Genetic engineering of T. weissflogii
Flux-derived Fe values compared to inorganic Fe
measurements
55Fe uptake kinetics
The Master Plan
Field testing
Cm -QR/(14.4pRD) Cs
Mass culturing of evil Super-Plankton for world
domination
Flux calculation for bioavailable Fe
10Methods and Associated Madness
Part 1 Gene Jockeying
GATTACGCTCTCTAATGAGAGA
11Methods and Associated Madness
Part 2 Nuke em All!
Section A incubation
24hrs
Low Fe AQUIL
55FeCl3
Modified T. w.
RadQUIL
Culture
Section B kinetics
Liquid scintillation counting
Uptake Rate
Saturation Curve
10min 3hr cell filtration
Ti(III) citrate EDTA
12Methods and Associated Madness
Part 2, cont Glow-in-the-dark weissflogii?
Section C diffusion differences
L.S.C.
Uptake Rate
Culture
Diffusion ligand
Ti(III) citrate EDTA
Section D non-equilibrium control
L.S.C.
Uptake Rate
Culture
Strong ligand
Ti(III) citrate EDTA
13Methods and Associated Madness
Part 3 Fluxing flocculations, Batman!
Cm -QR/(14.4pRD) Cs
CM bioavailable Fe concentration QR rate of
transport to the cell (flux) p
3.1415926535897932384626433832795 R mean
cell radius D diffusivity constant Cs
cell surface bioavailable Fe concentration
Unknown
55Fe uptake
Natural constant
Microscope
Literature
Genetically set to zero
14In Conclusion
- Fe is an important element with wide-ranging
effects, especially on oceanic biology - Current methodologies do not give a sufficiently
accurate measure of bioavailable Fe - The 55Fe flux approach will be valuable for
determining Fe limitation, as well as for
understanding Fe-involved biogeochemical processes
15To Inquire, or Not to InquireAny Other Questions?
?
16Youve Gone Too Far!Go Back, Go Back!
17Random Data Slides