In the Name of Allah, the Most Gracious, the Most Merciful

1
In the Name of Allah, the Most Gracious, the Most
Merciful
2
Miracles of Knowledge Found in The Noble Quran
and The Teachings of Prophet Mohammad Peace Be
Upon Him

• Dr. Zaid Kasim Ghazzawi
• Ph.D. in Biomedical Engineering
• University of Surrey England
• E-mail zaidquran_at_yahoo.com
• Website www.quran-miracle.com

3
The Creation of Jesus Peace Be Upon Him from A
Scientific Point of View

• As stated in the last revelation of Allah (God)
  Almighty to mankind the Noble Quran

4
The Description of Jesus PBUH in the Noble Quran
5
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (4 171)

• 171. O people of the Scripture (Jews and
  Christians)! Do not exceed the limits in your
  religion, nor say of Allah (God) Almighty aught
  but the truth. The Messiah 'Iesa (Jesus), son of
  Maryam (Mary), was (no more than) a Messenger of
  Allah (God) and His Word, ("Be!" - and he was)
  which He bestowed on Maryam (Mary) and a spirit
  (Rûh) created by Him so believe in Allâh and
  His Messengers. Say not "Three (trinity)!"
  Cease! (it is) better for you. For Allâh is (the
  only) One Ilâh (God), Glory be to Him (Far
  Exalted is He) above having a son. To Him belongs
  all that is in the heavens and all that is in the
  earth. And Allâh is AllSufficient as a Disposer
  of affairs

6
The Description of Jesus Peace be Upon Him in The
Noble Quran
7
A Logical Argument and Historical Facts which
testify to the fact that Jesus PBUH is a
messenger of Allah (God) Almighty and nothing
more
8
Allahs (God) Almighty Infinite Mercy to Mankind
7. Allah (God) Almighty has encompassed
everything in mercy and knowledge
The Noble Quran (40 7)
Mercy requires that Allah (God) Almighty should
send messengers to guide people and these
messengers should be 100 man and nothing more,
why?
Because if the messenger is more than a man then
people can not relate to him
For example how can the messenger teach you about
patience when enduring pain if he was more than a
man?
9
Allahs infinite mercy to mankind
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (3543)

• 43. So no change will you find in Allah's
  (God) Almighty Sunnah (way of dealing), and no
  turning off will you find in Allah's Sunnah (way
  of dealing)

10
(No Transcript)
11

• The Message of Islam
• - Universal message
• Continuing Miracle of the
• Noble Quran

12
It is illogical to think of Jesus (PBUH) to be
more than a prophet because

• It is against the Sunnah (Way) of Allah (God) all
  
• Mighty throughout the ages to send a person
  who is more than a prophet.
• People can not relate to Jesus (PBUH) if He was
  more than a prophet, because
• If he feels pain (does he really ?)
• How could he teach people about patience?

13
The continuing miracle of the Nobel Quran and
the promise of Allah All Mighty to People
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (41 53)

• 53. Allah (God) Almighty will show humans His
  signs in what surrounds them and in themselves
  until it manifests to them that the Noble Quran
  is the truth. Is not it sufficient that Allah
  (God) Almighty is a witness over all things?

14
How was Jesus peace be upon Him created from a
scientific point of view?

• The answer can be found in the Noble Quran

15
The Answer can be Found in The Noble Quran (3
59)

• Which states the Perfect Correlation between the
  Creation of Adam and that of Jesus Peace be upon
  Him

16
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (3 59)
59. Verily, the likeness of 'Iesa (Jesus) in the
sight of Allah (God) Almighty is the likeness of
Adam. He created him from soil, then (He) said to
him "Be!" - and he was.
17
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
59. Verily, the likeness of 'Iesa (Jesus) in the
sight of Allah (God) Almighty is the likeness of
Adam. He created him from soil, then (He) said to
him "Be!" - and he was.
The Noble Quran (3 59)
Stages involved in the creation of Jesus peace be
upon Him
Stages involved in the creation of Adam peace be
upon Him
Since Allah (God) Almighty states that He created
Jesus peace be upon Him exactly like Adam. Thus
the components comprising the body of Jesus peace
be upon Him should be found in the Soil.
Allah (God) Almighty created Him from the Soil,
which indicates that the components comprising
the physical body of Adam peace be upon Him are
to be found in the soil
18
Analysis of Elements Found in The Soil

• Iodine (I)
• Ferrous (Fe)
• Copper (Cu)
• Silicon (Si)

• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)
• Calcium (Ca)
• Phosphorus (P)
• Potassium (K)
• Sulfur (S)
• Sodium (Na)
• Chlorine (Cl)
• Magnesium (Mg)

19
Elements Comprising The Basic Building Blocks of
the Human Body(i.e. Amino Acids)

• Elements Comprising Amino Acids
• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)

• Elements in The Soil
• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)

http//www.chemie.fu-berlin.de/chemistry/bio/amino
-acids_en.html
20
The Use of the Elements Found in The Soil In the
Physiological Functions of The Human Body

• Sodium (Na) and Potassium (K) are used in the
  transmission of neural signals
• Calcium (Ca) is used in cell signaling and muscle
  function
• Ferrous (Fe) is used in mass bio-transport in the
  human body
• Phosphorus (P) is used in the construction of
  bone material
• Iodine (I) is needed for healthy functioning of
  glands
• Chlorine (Cl) is used to maintain fluids balance
• Copper (Cu) is used in the transmission of
  electrical signals
• Silicon (Si) is a constructional material in the
  human body
• Sulfur (S) is used in muscular proteins
• Magnesium (Mg) is used in the construction of
  bone material

21

• Constructional Material (Amino Acids)
• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)
• Functional Material
• Calcium (Ca)
• Phosphorus (P)
• Potassium (K)
• Sulfur (S)
• Sodium (Na)
• Chlorine (Cl)
• Magnesium (Mg)
• Iodine (I)
• Ferrous (Fe)
• Copper (Cu)
• Silicon (Si)

Perfect correlation between the elements found in
the soil and those found in the human body
22
Perfect Correlation between the Creation of Adam
and Jesus Peace Be Upon Them
Jesus peace be upon Him was created from the
components found in the body of Mary peace be
upon Her
Adam peace be upon Him was created from the
components comprising the soil
And since the components found in the body of
Mary peace be upon Her are the same as in the
Soil (as the case of every human), then Jesus
peace be upon Him is created from the soil as
Allah (God) Almighty states in the Noble Quran
23
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
59. Verily, the likeness of 'Iesa (Jesus) in the
sight of Allah (God) Almighty is the likeness of
Adam. He created him from soil, then (He) said to
him "Be!" - and he was.
The Noble Quran (3 59)
Stages involved in the creation of Adam peace be
upon Him
Stages involved in the creation of Jesus peace be
upon Him
Allah (God) Almighty created Him from the Soil,
which indicates that the components comprising
the physical body of Adam peace be upon Him are
to be found in the soil
Since Allah (God) Almighty states that He created
Jesus peace be upon Him exactly like Adam. Thus
the components comprising the body of Jesus peace
be upon Him should be found in the Soil.
Then Allah (God) Almighty said to Jesus peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Jesus peace be upon him
Then Allah (God) Almighty said to Adam peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Adam peace be upon him
24
How is Jesus PBUH and Adam PBUH A Word from Allah
(God) Almighty?

• As viewed from a scientific point of view

25
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (27 88)
88. And you see the mountains and think them
solid without movement, but they pass away as the
passing away of the clouds. The manufacturing of
Allah (God) Almighty, Who perfected all things,
verily! He is Well-Acquainted with what you do.
The Mountains
A created being of Allah (God) Almighty
And a manufactured product needs instructions
(words) on how the components need to be
assembled
Allah (God) Almighty describes that it is created
by a process of manufacturing
26
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (82 8)
8. In whatever form Allah (God) Almighty willed
He assembled you together
Thus there is a need for the information which
describes the sequence and number of the basic
units to be assembled
Allah (God) Almighty describes that the human
body is made in a process of assembly
This information is the word of Allah (God)
Almighty for creation (Be and it is)
27
The word of Allah (God) Almighty for creation is
found in the DNA molecule

• Storing information using a geometric code

28
DNA molecule
Tortora and Grabowski, 1996
29
Amino acids
http//www.chemie.fu-berlin.de/chemistry/bio/amino
-acids_en.html
30
Every three geometrical units codes for one amino
acid
DNA Molecule
Amino Acids
31
The word for the creation of collagen protein
(Storing of Information using a geometrical code)

Assembly of amino acids in a specific type,
number, and sequence to create proteins
32
The Manufacturing of Proteins within the Human
Body
33
Collagen type V sequenceThe Word of Allah (God)
Almighty to create The Collagen Protein
Start codon

• AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGGGCCCATCTGGCCCACGT
  CTCCTGTCTCGCCCTTTTCTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
  ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAACCTTCATCTCCTTTC
  TGCCCAAACAGGCCCTGCTGTCCACGAGGGCCAGGTTCACCATCTGCTCC
  CG AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGACCGGTAGGCCCAGG
  AGGACCCTGCTCGCCTTTGTCGCCCTTGCTTCCCTTCTGCCCTGGCTCTC
  CGATC

34
The production of collagen proteins within the
human body
???? ?????????
Tortora and Grabowski, 1996
35
Sequence for Elastin Molecule The Word of Allah
(God) Almighty to create The Elastin Protein

• 1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc
  gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc
  catcccgcgc agcctggagg ggttccagga gctgtgcctg 121
  gcggacttcc tggtggagtt cccggtggag tctattatcc
  aggggctggt attggaggcc 181 tgggaggagg aggaggagct
  ctgggacctg gaggaaaacc acctaagcca ggtgccggac 241
  ttctgggaac gtttggagca ggtcctggag gacttggagg
  tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc
  accttcccag gggcaggagc tctggtgccc gggggagcag 361
  caggggctgc tgcggcttat aaagctgccg ccaaagctgg
  ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt
  ggcgttggtg gagttccagg tggtgttgga gttggcggag 481
  tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt
  tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca
  ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601
  gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg
  tgtataccca ggcggagtgc 661 tcccaggaac aggagctcgg
  ttccctggtg tgggggtgct ccctggagtt cccactggca 721
  caggagtcaa agccaaggct ccaggtggag gtggtgcttt
  tgctggaatc ccaggggtcg 781 gaccctttgg gggtcagcag
  cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841
  tgccaggtgg ctacggactg ccctatacca atgggaaatt
  gccctatgga gtagctggtg 901 cagggggcaa ggctggctac
  ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961
  cagctaaagc agccaagtat ggtgctgggg gagctggagt
  cctccctggt gttggagggg 1021 gtggcattcc tggtggtgct
  ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081
  ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc
  tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga
  ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201
  gtggcattcc tggtgttggt ggcatcccag gtgttggggg
  ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga
  gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321
  ctgccaaata cggagccaga ggtggagttg gcatcccgac
  atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt
  ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441
  ctgctgccgc cgccaaagct gctaagtatg gtgctggagg
  agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca
  ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561
  gtggagtgcc aggagcaggt acccctgcag ctgcagctgc
  tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt
  cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681
  ggattcccgg tggagttggt gttggtgggg ttcctggtgg
  agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct
  ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801
  ctgctgctaa ggcagctgcc aaagcccagt acagagctgc
  cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt
  gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921
  gatttggggc tggtgctggt gtccccggat ttggggctgg
  tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga
  tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041
  gtggccttgg tggccctgga ggtctcggtg gccctggagg
  tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc
  ggtagagtag caggagctgc accccctgct gctgccgctg 2161
  ctgctgccaa agctgctgct aaggctgccc agtatggcct
  tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc
  ggtggactgg gagccggtgg actgggagct ggtggactgg 2281
  gagccggtgg actgggagct ggtggactgg gagccggtgg
  actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct
  aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401
  taggagccag gccattccca ggtggaggag ttgcagcaag
  acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt
  gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521
  atggaggagc ccttggagcc ctgggatacc aaggtggggg
  ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct
  tctggggacc cctgactcgc gacctcatca acgttggtgc 2641
  tactgcttgg tggagaatgt aaaccttcta tgaccacccc
  ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca
  ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761
  cagcagcagc catgcagccc taaccagaaa ctccccccac
  cctatatcag aggccagggc 2821 gggtgtccca tctcttccca
  cccaggagct cccccccaca gtctccatct ccaagggaaa 2881
  ttggtgctac atgttggtgc ttcttctttg tggggggagg
  gaggagggaa gggtatccca 2941 ggggggattg cccccttccc
  tgaagcccct ctattaagat ggtgcacacc tttgttgggc 3001
  agtcccacct ccccctgccc accaggagcc attcctggct
  gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg
  gatttggtga catgatccct ctctctttgg ttcccctgtc 3121
  cctgcctcct gttacctaaa gctacttccc acatctggga
  caccctggag tcagatggct 3181 cctcacactg ggaatagctc
  ccttgttctt atggaatcca cctgccatcc acccatccac 3241
  ctactcatcc atccatccat ccatccatcc atccgtccat
  cttgactgcc tagtaccact 3301 aagctggctg ggcataccca
  ctatcaacct ggttcacctg tcatggcagc ctgtccccgt 3361
  ccccaccaca caccccgatc ctggcctagg gtgcaaaggg
  ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc
  cgttcttcct ggagccactc ttacagagca tgtctcacca 3481
  ccccacctct ttgtgtttcg ctgtgataga tcaataaaat
  attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga
  ttgttggtgt gctctttggg tttatttttg tggctaattg 3601
  gggagagaga gagagaaaaa aaaatttcta atctggggag
  ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta
  taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721
  cgaaataaga aaagagaatt aattgctcta gcaatgacta
  ataaatataa actttttaaa 3781 gg

36
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (18 109)
109. Say (O Muhammad peace be upon Him to
mankind). "If the sea were ink for (writing) the
Words of my Lord, surely, the sea would be
exhausted before the Words of my Lord would be
finished, even if we brought (another sea) like
it for its aid."
37
The human body is created in a process of assembly
38
The word that Allah (God) Almighty bestowed upon
Mary peace be upon Her

• The Word that became Jesus peace be upon Him
• Is the information containing the characteristics
  of Jesus peace be upon Him with respects to
• The sequence of the amino acids to be assembled
  and their number
• The color of the eyes, hair, skin, etc. of Jesus
  peace be upon Him.

39
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
59. Verily, the likeness of 'Iesa (Jesus) in the
sight of Allah (God) Almighty is the likeness of
Adam. He created him from soil, then (He) said to
him "Be!" - and he was.
The Noble Quran (3 59)
Stages involved in the creation of Adam peace be
upon Him
Stages involved in the creation of Jesus peace be
upon Him
Allah (God) Almighty created Him from the Soil,
which indicates that the components comprising
the physical body of Adam peace be upon Him are
to be found in the soil
Since Allah (God) Almighty states that He created
Jesus peace be upon Him exactly like Adam. Thus
the components comprising the body of Jesus peace
be upon Him should be found in the Soil.
Then Allah (God) Almighty said to Adam peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Adam peace be upon him
Then Allah (God) Almighty said to Jesus peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Jesus peace be upon him
Then Allah (God) Almighty integrated from His
spirit into the physical created body of Adam
peace be upon Him
Then Allah (God) Almighty integrated from His
spirit into the physical created body of Jesus
peace be upon Him
40
How is Jesus PBUH and Adam PBUH A Spirit from
Allah (God) Almighty?

• As viewed from a scientific point of view

41
What is the function of the soul?

• The body of Adam peace be upon Him without the
  soul could not walk, think, etc. (i.e. could not
  function)
• Thus it can be deduced that the soul is needed to
  stimulate neural nodes in the brain to initiate
  and maintain function
• The soul is an energy field which is integrated
  in the physical body of a human that causes
  function by stimulating neural pathways in the
  brain

42
The Physical Body of a Human
43
Tortora and Grabowski, 1996
The energy field within the human body
???? ?????? ?????? ?? ????? ???? ???????? ?? ????
??? ?????
The Human Body
44
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
Integrating a soul into the physical body of Adam
peace be upon Him
The Noble Quran (15 28-29)
28. And (remember) when your Lord said to the
angels "I am going to create a man (Adam) from
sounding clay of altered black smooth mud. 29.
"So, when I have fashioned him completely and
breathed into him (Adam) the soul which I created
for him, then fall (you) down prostrating
yourselves unto him."
Integrating a soul into the physical body of
Jesus peace be upon Him
The Noble Quran (21 91)
91. And (remember) she who guarded her chastity
Virgin Maryam (Mary), We breathed into her
through Our Rûh Jibrael (Gabriel( and Allah
(God) Almighty made her and her son 'Iesa
(Jesus) a sign for Al-'Alamin (All that exists)
45
Dr. Zaid Kasim Ghazzawi Ph.D. in Biomedical
Engineering University of Surrey - England
Website www.quran-miracle.com
E-mail zaidquran_at_yahoo.com zaidg_at_hotmail.com