The repair of a double-strand break in DNA by homologous end-joining.

1
The repair of a double-strand break in DNA by
homologous end-joining.
Damaged site is copied from the other chromosome
by recombination proteins
2
Double strand repair

• Nonhomologous end-joining
• only in emergency situations
• Two broken ends of DNA are joined together.
• A couple of nucleotides are cut from both of the
  strands.
• Ligase joins the strands together.
• Sometimes an extra nucleotide is added.

3
Nonhomologous End Joining
4
Construct design in this paper is more complex,
but the idea is the same.

• Reporter gene is GFP. Since repair is taking
  place in a eukaryotic system, ds breaks must be
  repaired, mRNAs synthesized and processed by
  normal splicing machinery to generate detectable
  levels of GFP.
• SceI sites produce HR sites in Construct B (next
  slide) and NHEJ type breaks in construct A.
• Constructs are integrated into the chromosomes

Sce I site
5
SD, splice donor SA, splice acceptor shaded
squares, polyadenylation sites.
Supplementary Figure 1. Constructs integrated in
the reporter cell lines for detecting NHEJ and
HR. A, NHEJ reporter cassette. The construct
consists of a GFP gene containing an intron,
interrupted by an adenoviral exon (Ad).The
adenoviral exon is flanked by SceI recognition
sites in inverted orientation for induction of
DSBs. Inverted orientation prevents overlap of
sticky ends produced by SceI cleavage (see Figure
1C). In the starting construct the GFP gene is
inactive. Induction of a DSB by I-SceI followed
by NHEJ, transcription and splicing reconstitutes
the functional GFP gene.
6
SceI recognition site

• TAGGGATAACAGGGTAATATC CCTATTGTCCC ATT
• ATCCC TATT GTCCCATTATAGGGATAACAGGGTAAT

Two SceI sites in inverted orientation make
incompatible sticky ends.
7
B, HR reporter cassette. The construct consists
of two mutated copies of GFP-Pem1. In the first
copy of GFP-Pem1 the first GFP exon carries a
deletion of 22 nt and an insertion of two I-SceI
recognition sites in inverted orientation. The 22
nt deletion ensures that GFP cannot be
reconstituted by an NHEJ event. The second copy
of GFP-Pem1 is lacking the ATG (for translation
initiation) and the second exon of GFP. Upon
induction of DSBs by I-SceI, gene conversion
events reconstitute the GFP gene.
8
The construct consists of two mutated copies of
GFP-Pem1. In the first copy of GFP-Pem1 the first
GFP exon carries a deletion of 22 nt and an
insertion of two I-SceI recognition sites in
inverted orientation. The 22 nt deletion ensures
that GFP cannot be reconstituted by an NHEJ
event. The second copy of GFP-Pem1 is lacking the
ATG and the second exon of GFP. Upon induction of
DSBs by I-SceI, gene conversion events
reconstitute the GFP gene.
1
2
9
Fig. 1 SIRT6 stimulates DSB repair.
Published by AAAS
Z Mao et al. Science 20113321443-1446
10
Fig. 1 SIRT6 stimulates DSB repair.
A) Overexpression of SIRT1, -2, -6, and -7 in
human fibroblasts. Immunoblotting with
sirtuin-specific antibodies after transfection
with a sirtuin-expressing vector or a control
vector encoding hypoxanthine-guanine
phosphoribosyltransferase (pControl).

• Z Mao et al. Science 20113321443-1446

Z Mao et al. Science 20113321443-1446
Published by AAAS
11
Fig. 1 SIRT6 stimulates DSB repair.
(B) Effect of sirtuin overexpression on the
efficiency of NHEJ and HR, measured as described
in (27) and fig. S1. The efficiency of DSB repair
was scored in untreated cells (open bars), cells
pretreated with 1 mM paraquat for 16 hours (black
bars), or cells treated with paraquat and 5 mM
nicotinamide for 16 hours (red bars). Error
bars indicate SD n 8 experiments (control and
SIRT6) n 3 (other sirtuins). P values were
calculated by two-tailed Students t test..
Z Mao et al. Science 20113321443-1446
Published by AAAS
12
Fig. 1 SIRT6 stimulates DSB repair.
(C) SIRT6 overexpression accelerates the
disappearance of ?H2AX foci after treatment with
1 mM paraquat for 16 hours. Data represents an
average of at least 50 nuclei.
13
Fig. 1 SIRT6 stimulates DSB repair.
(D) Immunoblot showing induction of endogenous
SIRT6 protein levels by oxidative stress. Human
fibroblasts were treated with paraquat for 16
hours.

• Z Mao et al. Science 20113321443-1446

Z Mao et al. Science 20113321443-1446
Published by AAAS
14
Fig. 2 Oxidative stress results in early
recruitment of SIRT6 to DNA breaks.
Oxidative stress results in early recruitment of
SIRT6 to DNA breaks. ChIP analysis showing
kinetics of SIRT6 recruitment to Alu sequences
after 8 Gy of ?-irradiation (IR) (A) and
sequences flanking I-SceIinduced DSB after
transfection with I-SceI expression vector (B).
Asterisks indicate values significantly different
from corresponding zero time points (P lt 0.05).
Error bars indicate SD n 5. Control ChIP with
SIRT6-/- cells is shown in fig. S7. IgG,
immunoglobulin G.
Z Mao et al. Science 20113321443-1446
Published by AAAS
15
Fig. 3 Deacetylation and mono-ADP-ribosylation
activities of SIRT6 are required to stimulate DSB
repair.

• Immunoblot showing that S56Y and R65A mutations
  abolish the H3K9 deacetylation activity of Sirt6
  and appear to exert a dominant-negative effect.
• (B) In vitro assay showing that S56Y and G60A
  mutations abolish mono-ADP-ribosylation activity
  of SIRT6. NAD, nicotinamide adenine
  dinucleotide.

Z Mao et al. Science 20113321443-1446
16
Fig. 3 Deacetylation and mono-ADP-ribosylation
activities of SIRT6 are required to stimulate DSB
repair.
(A) Immunoblot showing that S56Y and R65A
mutations abolish the H3K9 deacetylation activity
of Sirt6 and appear to exert a dominant-negative
effect. (B) In vitro assay showing that S56Y and
G60A mutations abolish mono-ADP-ribosylation
activity of SIRT6. NAD, nicotinamide adenine
dinucleotide. (C) SIRT6 mutants for
deacetylation and/or ribosylation activities have
reduced ability to stimulate NHEJ and HR.
Untreated cells (open bars) or cells treated with
paraquat (black bars) were transfected with
SIRT6-expressing vectors or pControl.
Z Mao et al. Science 20113321443-1446
17
Fig. 4 SIRT6 interacts with PARP1 and stimulates
its poly-ADP-ribosylation activity.
Z Mao et al. Science 20113321443-1446

• (A) Analysis of mono-ADP-ribosylated proteins in
  the WT and SIRT6-/- MEFs stressed with paraquat
  for 16 hours. Cells were transfected with
  biotinylated NAD, and poly-ADP-ribosylated
  proteins were cleared away with PAR antibodies.
• (B) Immunoblotting of the extracts in (A) with
  PARP1 antibodies indicated that the 120-kD band
  is Parp1.
• (C) SIRT6 interacts with PARP1. Human fibroblasts
  were treated with 1 mM paraquat. Cell lysates
  were immunoprecipitated with SIRT6 antibodies in
  the presence of ethidium bromide (EtBr) followed
  by Western blotting with PARP1 antibodies.

18

• (E) PARP1 lacking the catalytic domain is
  mono-ADP-ribosylated by SIRT6 in vitro, whereas
  K521A is not.
• (F) In vitro assay of PARP1 poly-ADP-ribosylation
  activity showing that PARP1 is stimulated only by
  SIRT6 mono-ADP-ribosylation activity. (G)
  Stimulation of NHEJ and HR by SIRT6 is abolished
  by PARP1 inhibitors 3-ABA or PJ34.

(D) PARP1 K521 is essential for activation of
NHEJ by SIRT6. An NHEJ assay was performed in
PARP1-/- MEFs containing an integrated NHEJ
reporter. Cells were transfected with SIRT6
and/or PARP1 or PARP1 mutants. Both SIRT6 and
PARP1 are required for the stimulation of repair.
PARP1 Y889C is a catalytically inactive PARP1.
PARP1 DEEKKK contains mutations in all six
poly-ADP-ribosylation sites. PARP1 DEEKK contains
the same mutations, except at K521. Asterisks
indicate values significantly different from
control (P lt 0.01).
19
(D) PARP1 K521 is essential for activation of
NHEJ by SIRT6. An NHEJ assay was performed in
PARP1-/- MEFs containing an integrated NHEJ
reporter. Cells were transfected with SIRT6
and/or PARP1 or PARP1 mutants. Both SIRT6 and
PARP1 are required for the stimulation of repair.
PARP1 Y889C is a catalytically inactive PARP1.
PARP1 DEEKKK contains mutations in all six
poly-ADP-ribosylation sites. PARP1 DEEKK contains
the same mutations, except at K521. Asterisks
indicate values significantly different from
control (P lt 0.01). (E) PARP1 lacking the
catalytic domain is mono-ADP-ribosylated by SIRT6
in vitro, whereas K521A is not.

• (F) In vitro assay of PARP1 poly-ADP-ribosylation
  activity showing that PARP1 is stimulated only by
  SIRT6 mono-ADP-ribosylation activity.
• (G) Stimulation of NHEJ and HR by SIRT6 is
  abolished by PARP1 inhibitors 3-ABA or PJ34.

20
Binding of Proteins to DNA Often Involves
Hydrogen Bonding
Types of domains that bind DNA Helix-turn-helix
Zinc Finger Leucine Zipper Helix-loop-helix
21
Functional groups on all four base pairs that are
displayed in the major and minor grooves of DNA
22
A H bond acceptor D H bond donor
23
Guanine-Arginine One of the most common
DNA-protein interactions. Because of its
specific geometry of H-bond acceptors, guanine
can be unambiguously recognized by the side
chain of arginine
24
(No Transcript)
25
Helix-Turn-Helix Motif is Common in DNA-Binding
Proteins

• One of the helixes (red) fits into the major
  groove of DNA
• Four DNA-binding helix-turn-helix motifs (gray)
  in the Lac repressor

26
Important Points a handshake leads to a bear-hug
Specific recognition of DNA targets by the
helix-turn-helix motif involves interactions
between sides of the recognition helix and bases
in the major groove of the DNA
But, specific recognition of DNA sequences is to
a large extent governed by other interactions
within complementary surfaces between the protein
and the DNA
These interactions frequently involve H-bonds
from protein main-chain atoms to the DNA backbone
in both the major and the minor groove and are
dependent on the sequence-specific deformability
of the target DNA
27
Helix-turn-helix. (a) DNA-binding domain of the
Lac repressor
The helix-turn-helix motif is shown in red and
orange the DNA recognition helix is red.
28
Helix-turn-helix. (c) Surface rendering of the
DNA-binding domain of the Lac repressor bound to
DNA.
29
The DNA-binding domain separated from the DNA,
with the binding interaction surfaces
shown. groups on the protein and DNA that
interact through H-bonding groups that interact
through hydrophobic interactions
30
Chapter 8 Summary
In this chapter, we learned about

• Function of nucleotides and nucleic acids
• Names and structures of common nucleotides
• Structural basis of DNA function
• Reversible denaturation of nucleic acids
• Chemical basis of mutagenesis

31
Hexons and pentons form capsid
(TP) Covalently linked to DNA
36 kbp
50 nm
Transcribed by RNA pol II
Transcribed by RNA pol III
Figure A-1 Adenovirus