Burkhard PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
Burkhard Militzer PowerPoint PPT Presentation
Burkhard Militzer - Trotter formula: ... The distribution P(ri) is Gaussian centered at the midpoint of ri-1 and ri 1 ... Feynman-Kac formula: ...
Trotter formula: ... The distribution P(ri) is Gaussian centered at the midpoint of ri-1 and ri 1 ... Feynman-Kac formula: ...
| PowerPoint PPT presentation | free to view
Amsterdam, Amsterdam -Forschungen eines Avatars- BukTom Bloch / Burkhard Tomm-Bub, M.A. f PowerPoint PPT Presentation
Amsterdam, Amsterdam -Forschungen eines Avatars- BukTom Bloch / Burkhard Tomm-Bub, M.A. f - Amsterdam, Amsterdam-Forschungen eines Avatars- BukTom Bloch / Burkhard Tomm-Bub, M.A. f r movement-for-account-corpses THE LAST DAYS OF SECOND LIFE
Amsterdam, Amsterdam-Forschungen eines Avatars- BukTom Bloch / Burkhard Tomm-Bub, M.A. f r movement-for-account-corpses THE LAST DAYS OF SECOND LIFE
| PowerPoint PPT presentation | free to download
Bioinformatics Methods Course Multiple Sequence Alignment Burkhard Morgenstern University of G PowerPoint PPT Presentation
Bioinformatics Methods Course Multiple Sequence Alignment Burkhard Morgenstern University of G - Astronomical Number of possible alignments! Tools for multiple sequence alignment ... `True' alignment known by information about structure or evolution. ...
Astronomical Number of possible alignments! Tools for multiple sequence alignment ... `True' alignment known by information about structure or evolution. ...
| PowerPoint PPT presentation | free to download
Exon prediction by Genomic Sequence alignment Burkhard Mo PowerPoint PPT Presentation
Exon prediction by Genomic Sequence alignment Burkhard Mo - Burkhard Morgenstern. Institut f r Mikrobiologie und Genetik ... Since mid-Eighties: Feng/Doolittle, Higgins/Sharp, Taylor, ... `Progressive' Alignment ...
Burkhard Morgenstern. Institut f r Mikrobiologie und Genetik ... Since mid-Eighties: Feng/Doolittle, Higgins/Sharp, Taylor, ... `Progressive' Alignment ...
| PowerPoint PPT presentation | free to download
Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner PowerPoint PPT Presentation
Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner - Sequence alignment in molecular data analysis: (M. Brudno) ... local alignment (Smith and Waterman, 1983) atctaatagttaatactcgtccaagtat ...
Sequence alignment in molecular data analysis: (M. Brudno) ... local alignment (Smith and Waterman, 1983) atctaatagttaatactcgtccaagtat ...
| PowerPoint PPT presentation | free to download
Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner PowerPoint PPT Presentation
Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner - s4 W R Y I A M R E - Q Y E - - - Alignment hypothesis about ... Estimate probabilities for individual evolutionary events: insertions/deletions, substitutions ...
s4 W R Y I A M R E - Q Y E - - - Alignment hypothesis about ... Estimate probabilities for individual evolutionary events: insertions/deletions, substitutions ...
| PowerPoint PPT presentation | free to download
Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner PowerPoint PPT Presentation
Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner - Task in bioinformatics: Find best multiple alignment for given sequence set ... Computer has to decide: which one is best?? Tools for multiple sequence alignment ...
Task in bioinformatics: Find best multiple alignment for given sequence set ... Computer has to decide: which one is best?? Tools for multiple sequence alignment ...
| PowerPoint PPT presentation | free to download
Rekonstruktion phylogenetischer B PowerPoint PPT Presentation
Rekonstruktion phylogenetischer B - Title: Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner Author: public Last modified by: Burkhard Created Date
Title: Exon prediction by Genomic Sequence alignment Burkhard Morgenstern and Oliver Rinner Author: public Last modified by: Burkhard Created Date
| PowerPoint PPT presentation | free to download
MRT des Thorax PowerPoint PPT Presentation
MRT des Thorax - MRT des Thorax Grundlagen Thorsten Burkhard Untersuchungstechnik Lagerung: head first supine Verwendung von geeigneten Oberfl chenspulen, besseres SNR als ...
MRT des Thorax Grundlagen Thorsten Burkhard Untersuchungstechnik Lagerung: head first supine Verwendung von geeigneten Oberfl chenspulen, besseres SNR als ...
| PowerPoint PPT presentation | free to download
Scoring:%20a%20novel%20approach%20towards%20automated%20certification%20of%20pipeline%20products PowerPoint PPT Presentation
Scoring:%20a%20novel%20approach%20towards%20automated%20certification%20of%20pipeline%20products - Scoring: a novel approach towards automated certification of pipeline products Reinhard Hanuschik, Wolfgang Hummel, Mark Neeser, Burkhard Wolff
Scoring: a novel approach towards automated certification of pipeline products Reinhard Hanuschik, Wolfgang Hummel, Mark Neeser, Burkhard Wolff
| PowerPoint PPT presentation | free to download
MRT des Thorax PowerPoint PPT Presentation
MRT des Thorax - MRT des Thorax Grundlagen Thorsten Burkhard Untersuchungstechnik Lagerung: head first supine Verwendung von geeigneten Oberfl chenspulen, besseres SNR als ...
MRT des Thorax Grundlagen Thorsten Burkhard Untersuchungstechnik Lagerung: head first supine Verwendung von geeigneten Oberfl chenspulen, besseres SNR als ...
| PowerPoint PPT presentation | free to download
Software Architectures for Agents and Mobile Robots PowerPoint PPT Presentation
Software Architectures for Agents and Mobile Robots - Software Architectures for Agents and Mobile Robots Hans-Dieter Burkhard Humboldt University Berlin Institute of Informatics www.ki.informatik.hu-berlin.de
Software Architectures for Agents and Mobile Robots Hans-Dieter Burkhard Humboldt University Berlin Institute of Informatics www.ki.informatik.hu-berlin.de
| PowerPoint PPT presentation | free to download
Kurs HLN PowerPoint PPT Presentation
Kurs HLN - High Speed Networks Technology and Applicatios Prof. Dr. Bernhard Plattner, Prof. Dr. Burkhard Stiller Institut f r Technische Informatik und Kommunikationsnetze
High Speed Networks Technology and Applicatios Prof. Dr. Bernhard Plattner, Prof. Dr. Burkhard Stiller Institut f r Technische Informatik und Kommunikationsnetze
| PowerPoint PPT presentation | free to download
NMR Nuclear Magnetic Resonance PowerPoint PPT Presentation
NMR Nuclear Magnetic Resonance - Terence N. Mitchellm Burkhard Costisella. C-13 NMR. C-13 NMR: Quantitative? ... Terence N. Mitchellm Burkhard Costisella. C13 extracting J values. AQ: C13. H1 ...
Terence N. Mitchellm Burkhard Costisella. C-13 NMR. C-13 NMR: Quantitative? ... Terence N. Mitchellm Burkhard Costisella. C13 extracting J values. AQ: C13. H1 ...
| PowerPoint PPT presentation | free to view
Software Architectures for Agents and Mobile Robots PowerPoint PPT Presentation
Software Architectures for Agents and Mobile Robots - Software Architectures. for Agents and Mobile Robots. Hans-Dieter Burkhard ... needs knowledge about teammate's intention. H.D.Burkhard, HU Berlin. MOCA 2002 ...
Software Architectures. for Agents and Mobile Robots. Hans-Dieter Burkhard ... needs knowledge about teammate's intention. H.D.Burkhard, HU Berlin. MOCA 2002 ...
| PowerPoint PPT presentation | free to view
Evolution teaches to predict protein structure and function PowerPoint PPT Presentation
Evolution teaches to predict protein structure and function - Sven Mika. Chien Peter Chen. Burkhard Rost. http://cubic.bioc.columbia.edu ... Hepan Tan. Columbia. Trevor Siggers. Columbia. Burkhard Rost (Columbia New York) ...
Sven Mika. Chien Peter Chen. Burkhard Rost. http://cubic.bioc.columbia.edu ... Hepan Tan. Columbia. Trevor Siggers. Columbia. Burkhard Rost (Columbia New York) ...
| PowerPoint PPT presentation | free to view
Euroheat PowerPoint PPT Presentation
Euroheat - Another future possibility to CHP: Heat recycling from plants producing biofuels ... Geothermal Energy in DHC, Burkhard Sanner, EGEC ...
Another future possibility to CHP: Heat recycling from plants producing biofuels ... Geothermal Energy in DHC, Burkhard Sanner, EGEC ...
| PowerPoint PPT presentation | free to view
ASTM E13.15 Analytical Data PowerPoint PPT Presentation
ASTM E13.15 Analytical Data - A set of tools, formats, and procedures for representing and ... 276 days until Xmas. XML Data. Result. Application Routine. 1. 2. 3. 4. Burkhard A. Sch fer ...
A set of tools, formats, and procedures for representing and ... 276 days until Xmas. XML Data. Result. Application Routine. 1. 2. 3. 4. Burkhard A. Sch fer ...
| PowerPoint PPT presentation | free to view
Adaptive End-to-End QoS Guarantees in IP Networks using an Active Network Approach PowerPoint PPT Presentation
Adaptive End-to-End QoS Guarantees in IP Networks using an Active Network Approach - IBM Research, Zurich Research Laboratory, Switzerland. Burkhard Stiller ... Computer Engineering and Networks Laboratory (TIK), ETH Z rich, Switzerland ...
IBM Research, Zurich Research Laboratory, Switzerland. Burkhard Stiller ... Computer Engineering and Networks Laboratory (TIK), ETH Z rich, Switzerland ...
| PowerPoint PPT presentation | free to download
High Oil Prices: PowerPoint PPT Presentation
High Oil Prices: - Air. Transport Freight. Freight traffic vol. Car. Train. Ship. Transport vehicles. Passenger cars ... burkhard.schade@ec.europa.eu. www.jrc.es. Thank you for ...
Air. Transport Freight. Freight traffic vol. Car. Train. Ship. Transport vehicles. Passenger cars ... burkhard.schade@ec.europa.eu. www.jrc.es. Thank you for ...
| PowerPoint PPT presentation | free to view
prof': richard horden ass' wieland schmidt students: simon vorhammer, robin renner PowerPoint PPT Presentation
prof': richard horden ass' wieland schmidt students: simon vorhammer, robin renner - prof': richard horden ass' wieland schmidt students: simon vorhammer, robin renner
prof': richard horden ass' wieland schmidt students: simon vorhammer, robin renner
| PowerPoint PPT presentation | free to view
Knowledge Visualization PowerPoint PPT Presentation
Knowledge Visualization - Title: Knowledge Visualization Author: tina Last modified by: tina Created Date: 5/2/2006 3:18:16 PM Document presentation format: Bildschirmpr sentation
Title: Knowledge Visualization Author: tina Last modified by: tina Created Date: 5/2/2006 3:18:16 PM Document presentation format: Bildschirmpr sentation
| PowerPoint PPT presentation | free to view
Alternative History of the Project, part I PowerPoint PPT Presentation
Alternative History of the Project, part I - Title: PowerPoint Presentation Last modified by: zjb Created Date: 1/1/1601 12:00:00 AM Document presentation format: On-screen Show Other titles
Title: PowerPoint Presentation Last modified by: zjb Created Date: 1/1/1601 12:00:00 AM Document presentation format: On-screen Show Other titles
| PowerPoint PPT presentation | free to download
Caustics of Catadioptric Cameras PowerPoint PPT Presentation
Caustics of Catadioptric Cameras - Caustics of Catadioptric Cameras Rahul Swaminathan, Michael D. Grossberg and Shree K. Nayar CAVE Lab, Columbia University ICCV Conference Vancouver, July 2001
Caustics of Catadioptric Cameras Rahul Swaminathan, Michael D. Grossberg and Shree K. Nayar CAVE Lab, Columbia University ICCV Conference Vancouver, July 2001
| PowerPoint PPT presentation | free to download
Kein%20Folientitel PowerPoint PPT Presentation
Kein%20Folientitel - Title: Kein Folientitel Last modified by: Landesrettungsverein Document presentation format: Benutzerdefiniert Company: MHH Other titles: Times New Roman Comic Sans ...
Title: Kein Folientitel Last modified by: Landesrettungsverein Document presentation format: Benutzerdefiniert Company: MHH Other titles: Times New Roman Comic Sans ...
| PowerPoint PPT presentation | free to download
Outline of Contents PowerPoint PPT Presentation
Outline of Contents - ... http://supertech.lcs.mit.edu/~cel/ Kai Hwang (Benchmarking) http://ceng.usc.edu/~kaihwang/ * A Special Journal on Interconnection Networks D Frank Hsu ...
... http://supertech.lcs.mit.edu/~cel/ Kai Hwang (Benchmarking) http://ceng.usc.edu/~kaihwang/ * A Special Journal on Interconnection Networks D Frank Hsu ...
| PowerPoint PPT presentation | free to view
Diapositiva 1 PowerPoint PPT Presentation
Diapositiva 1 - ... es extremadamente resistente al paso del tiempo, no se deforma, ni se raja con las variaciones ... como una de Las Nuevas Siete Maravillas del Mundo Moderno.
... es extremadamente resistente al paso del tiempo, no se deforma, ni se raja con las variaciones ... como una de Las Nuevas Siete Maravillas del Mundo Moderno.
| PowerPoint PPT presentation | free to view
How to make biochar PowerPoint PPT Presentation
How to make biochar - Technical University of Dresden, Germany University of Stockholm, Sweden Max Planck Institute for Developmental Biology, Germany Leibniz University, Hanover, Germany
Technical University of Dresden, Germany University of Stockholm, Sweden Max Planck Institute for Developmental Biology, Germany Leibniz University, Hanover, Germany
| PowerPoint PPT presentation | free to download
Smectic phases in polysilanes PowerPoint PPT Presentation
Smectic phases in polysilanes - It looked like this: * polysilane (inorganic polymer) ...-SiH2-SiH2-SiH2 ... polydispersity nematic* linear relation between polymer length and smectic ...
It looked like this: * polysilane (inorganic polymer) ...-SiH2-SiH2-SiH2 ... polydispersity nematic* linear relation between polymer length and smectic ...
| PowerPoint PPT presentation | free to download
Oncologic Drugs Advisory Committee PowerPoint PPT Presentation
Oncologic Drugs Advisory Committee - Breast cancer and multiple myeloma. Prostate and other solid tumors ... Questions and Answers. Novartis Oncology. Clinical Research and Development. ...
Breast cancer and multiple myeloma. Prostate and other solid tumors ... Questions and Answers. Novartis Oncology. Clinical Research and Development. ...
| PowerPoint PPT presentation | free to view
Knowledge Visualization PowerPoint PPT Presentation
Knowledge Visualization - enables the correct reconstruction, remembrance and appliance of these insights. 5 ... prototype 3 days on website. 33 clicks. useful and interesting ...
enables the correct reconstruction, remembrance and appliance of these insights. 5 ... prototype 3 days on website. 33 clicks. useful and interesting ...
| PowerPoint PPT presentation | free to view
Caustics of Catadioptric Cameras PowerPoint PPT Presentation
Caustics of Catadioptric Cameras - Catadioptric Systems: Single Viewpoint. ... Hyperbola : e 1. Conic Catadioptric Cameras. Imaging plane. Reflector. O. p. Reflector ...
Catadioptric Systems: Single Viewpoint. ... Hyperbola : e 1. Conic Catadioptric Cameras. Imaging plane. Reflector. O. p. Reflector ...
| PowerPoint PPT presentation | free to download
International Terrorism and Lightning PowerPoint PPT Presentation
International Terrorism and Lightning - Title: International Terrorism and Lightning Author: J Mueller Last modified by: POLISCI Created Date: 6/19/1999 2:04:49 PM Document presentation format
Title: International Terrorism and Lightning Author: J Mueller Last modified by: POLISCI Created Date: 6/19/1999 2:04:49 PM Document presentation format
| PowerPoint PPT presentation | free to download
International Terrorism and Lightning PowerPoint PPT Presentation
International Terrorism and Lightning - (not pictured below)
(not pictured below)
| PowerPoint PPT presentation | free to download
A bottom-up approach to data calibration Carlo Izzo PowerPoint PPT Presentation
A bottom-up approach to data calibration Carlo Izzo - A bottom-up approach to data calibration Carlo Izzo
A bottom-up approach to data calibration Carlo Izzo
| PowerPoint PPT presentation | free to download
Integraci PowerPoint PPT Presentation
Integraci - Integraci n de datos evolutivos en la predicci n de estructura y funci n Alfonso Valencia CNB - CSIC
Integraci n de datos evolutivos en la predicci n de estructura y funci n Alfonso Valencia CNB - CSIC
| PowerPoint PPT presentation | free to download
V PowerPoint PPT Presentation
V - Title: PowerPoint Presentation Author: V voj Last modified by: Admin Created Date: 1/1/1601 12:00:00 AM Document presentation format: P edv d n na obrazovce (4:3)
Title: PowerPoint Presentation Author: V voj Last modified by: Admin Created Date: 1/1/1601 12:00:00 AM Document presentation format: P edv d n na obrazovce (4:3)
| PowerPoint PPT presentation | free to download
NMR Nuclear Magnetic Resonance PowerPoint PPT Presentation
NMR Nuclear Magnetic Resonance - Anisotropy of Aromatic compounds: in plane and above. dring 8.14-8.64 ppm. dMe -4.25 ppm ... dring 7.27-6.95 ppm. dMe -0.51 ppm. dOUTSIDE 9.28 ppm. dINSIDE ...
Anisotropy of Aromatic compounds: in plane and above. dring 8.14-8.64 ppm. dMe -4.25 ppm ... dring 7.27-6.95 ppm. dMe -0.51 ppm. dOUTSIDE 9.28 ppm. dINSIDE ...
| PowerPoint PPT presentation | free to view
ASTM E13'15 AnIML Task Group PowerPoint PPT Presentation
ASTM E13'15 AnIML Task Group - Working Group Meeting at PittCon 05. Working Group Virtual ... NMR (no one selected; need help from Bruker, JEOL, Varian, & Acorn) CORE Developer Group: ...
Working Group Meeting at PittCon 05. Working Group Virtual ... NMR (no one selected; need help from Bruker, JEOL, Varian, & Acorn) CORE Developer Group: ...
| PowerPoint PPT presentation | free to view
Flexible Mirror Imaging PowerPoint PPT Presentation
Flexible Mirror Imaging - Flexible Mirror Imaging
Flexible Mirror Imaging
| PowerPoint PPT presentation | free to download
Titel of Talk continued or subtitle to follow, whatever needed PowerPoint PPT Presentation
Titel of Talk continued or subtitle to follow, whatever needed - 1 Department of Informatics IFI, Communication Systems Group CSG, ... To be used cautiously, since it is NOT the intention to squeeze all data on one ...
1 Department of Informatics IFI, Communication Systems Group CSG, ... To be used cautiously, since it is NOT the intention to squeeze all data on one ...
| PowerPoint PPT presentation | free to view
7th Workshop PowerPoint PPT Presentation
7th Workshop - English, materials used in 2 different courses since 2004; ... Berlin: 4 times (transparencies) 5 times (ppt), German, 80 participants ...
English, materials used in 2 different courses since 2004; ... Berlin: 4 times (transparencies) 5 times (ppt), German, 80 participants ...
| PowerPoint PPT presentation | free to view
8th Workshop PowerPoint PPT Presentation
8th Workshop - English, materials used in 2 different courses since 2004; ... Berlin: 4 times (transparencies) 6 times (ppt), German, 80 participants ...
English, materials used in 2 different courses since 2004; ... Berlin: 4 times (transparencies) 6 times (ppt), German, 80 participants ...
| PowerPoint PPT presentation | free to view
Aucun titre de diapositive PowerPoint PPT Presentation
Aucun titre de diapositive - je trouvais au fond de ses yeux, Toutes les joies. que les enfants d sirent. Il me prenait ... si beau, si doux, si merveilleux, Il comprenait. la moindre de mes ...
je trouvais au fond de ses yeux, Toutes les joies. que les enfants d sirent. Il me prenait ... si beau, si doux, si merveilleux, Il comprenait. la moindre de mes ...
| PowerPoint PPT presentation | free to view
Le Laboratoire d PowerPoint PPT Presentation
Le Laboratoire d - Le Laboratoire d Epid miologie et de Sant Publique UCB-Lyon1 R sultats s lectionn s P. Vanhems, PU-PH
Le Laboratoire d Epid miologie et de Sant Publique UCB-Lyon1 R sultats s lectionn s P. Vanhems, PU-PH
| PowerPoint PPT presentation | free to download
Optimal probing strategies with applications to Biomolecular NMR PowerPoint PPT Presentation
Optimal probing strategies with applications to Biomolecular NMR - Optimal probing strategies with applications to Biomolecular NMR Protein NMR Spectroscopy One dimensional spectrum Optimal Control in Presence of Relaxation ...
Optimal probing strategies with applications to Biomolecular NMR Protein NMR Spectroscopy One dimensional spectrum Optimal Control in Presence of Relaxation ...
| PowerPoint PPT presentation | free to view
Highlights of IEEE VTS Cosponsored: The Fully Networked Car at 09 Geneva Auto Show PowerPoint PPT Presentation
Highlights of IEEE VTS Cosponsored: The Fully Networked Car at 09 Geneva Auto Show - Highlights of IEEE VTS Cosponsored: The Fully Networked Car at 09 Geneva Auto Show
Highlights of IEEE VTS Cosponsored: The Fully Networked Car at 09 Geneva Auto Show
| PowerPoint PPT presentation | free to view
Structure%20Prediction%20in%201D PowerPoint PPT Presentation
Structure%20Prediction%20in%201D - Find out whether a helix or strand is extended or shortened in the homolog. ... Extend helix in both directions until a set of four residues have an average P(H) ...
Find out whether a helix or strand is extended or shortened in the homolog. ... Extend helix in both directions until a set of four residues have an average P(H) ...
| PowerPoint PPT presentation | free to download
Worldwide Protein Data Bank PowerPoint PPT Presentation
Worldwide Protein Data Bank - ... and quality assessment information. Additional information should be available, including: ... however Journals need to check validity of IDCODE ...
... and quality assessment information. Additional information should be available, including: ... however Journals need to check validity of IDCODE ...
| PowerPoint PPT presentation | free to download
M1 Status PowerPoint PPT Presentation
M1 Status - Cross-check calculations with measurements (weight) ... Ground Braids (v) 0.011. Al bars. Balconies. 0.034. Al 3 mm. Walls t /X0 (h) mostly horizontal ...
Cross-check calculations with measurements (weight) ... Ground Braids (v) 0.011. Al bars. Balconies. 0.034. Al 3 mm. Walls t /X0 (h) mostly horizontal ...
| PowerPoint PPT presentation | free to download
Vehicle-Infrastructure Integration: Test Bed and Model Deployment PowerPoint PPT Presentation
Vehicle-Infrastructure Integration: Test Bed and Model Deployment - HNTB with PB, Kimley-Horn. Motorola. Daktronics. University of Michigan. Motor City. 24. 24. Emphasis on Information. Integration of Test Beds. Further Development ...
HNTB with PB, Kimley-Horn. Motorola. Daktronics. University of Michigan. Motor City. 24. 24. Emphasis on Information. Integration of Test Beds. Further Development ...
| PowerPoint PPT presentation | free to view
SIMILARITY%20SEARCH%20The%20Metric%20Space%20Approach PowerPoint PPT Presentation
SIMILARITY%20SEARCH%20The%20Metric%20Space%20Approach - Title: PowerPoint Presentation Author: xdohnal Last modified by: xdohnal Created Date: 1/1/1601 12:00:00 AM Document presentation format: P edv d n na obrazovce ...
Title: PowerPoint Presentation Author: xdohnal Last modified by: xdohnal Created Date: 1/1/1601 12:00:00 AM Document presentation format: P edv d n na obrazovce ...
| PowerPoint PPT presentation | free to download
Fisica Computazionale applicata alle Macromolecole PowerPoint PPT Presentation
Fisica Computazionale applicata alle Macromolecole - Title: Fisica Computazionale applicata alle Macromolecole Author: biocomp Last modified by: Piero Created Date: 5/25/2003 2:13:37 PM Document presentation format
Title: Fisica Computazionale applicata alle Macromolecole Author: biocomp Last modified by: Piero Created Date: 5/25/2003 2:13:37 PM Document presentation format
| PowerPoint PPT presentation | free to download
Bioinformatics PowerPoint PPT Presentation
Bioinformatics - Bioinformatics
Bioinformatics
| PowerPoint PPT presentation | free to download
Some gory details of protein secondary structure prediction PowerPoint PPT Presentation
Some gory details of protein secondary structure prediction - Some gory details of protein secondary structure prediction
Some gory details of protein secondary structure prediction
| PowerPoint PPT presentation | free to view


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2024 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
burkhard — Search results on PowerShow.com