620 Macaque PPTs View free & download

Modeling Primary Visual Cortex (of Macaque) PowerPoint PPT Presentation

Modeling Primary Visual Cortex (of Macaque) - Modeling Primary Visual Cortex (of Macaque) David W. McLaughlin Courant Institute & Center for Neural Science New York University dmac@courant.nyu.edu

Modeling Primary Visual Cortex (of Macaque) David W. McLaughlin Courant Institute & Center for Neural Science New York University dmac@courant.nyu.edu

| PowerPoint PPT presentation | free to download

The SIV Macaque Model of - The SIV Macaque Model of

The SIV Macaque Model of

| PowerPoint PPT presentation | free to view

Lessons from vervets and macaques PowerPoint PPT Presentation

Lessons from vervets and macaques - 3 main types of predator, and 3 alarm calls. Eagle gets a Cough, Snake gets a Chutter ... So monkeys respond to acoustic signals, not just to signaller's ...

3 main types of predator, and 3 alarm calls. Eagle gets a Cough, Snake gets a Chutter ... So monkeys respond to acoustic signals, not just to signaller's ...

| PowerPoint PPT presentation | free to view

Lessons from vervets and macaques - Not in squirrel monkey - innate. Perhaps in X-fostered Japanese & rhesus ... e.g., snake track on ground, or antelope carcass stored in tree (which signals ...

Not in squirrel monkey - innate. Perhaps in X-fostered Japanese & rhesus ... e.g., snake track on ground, or antelope carcass stored in tree (which signals ...

| PowerPoint PPT presentation | free to view

Adaptation Changes the Direction Tuning of Macaque MT Neurons Adam Kohn PowerPoint PPT Presentation

Adaptation Changes the Direction Tuning of Macaque MT Neurons Adam Kohn - 71 MT units from 12 macaque monkeys. All receptive fields were ... tuning bandwidth decreases substantially, owing to maintained inhibition from remote cells. ...

71 MT units from 12 macaque monkeys. All receptive fields were ... tuning bandwidth decreases substantially, owing to maintained inhibition from remote cells. ...

| PowerPoint PPT presentation | free to view

Chemo and Immunoprophylaxis of infant macaques against SIV' PowerPoint PPT Presentation

Chemo and Immunoprophylaxis of infant macaques against SIV' - California National Primate Research Center. Dec. 12-13, ... California National Primate Research Center. Gilead Sciences. Norbert Bischofberger John Desja ...

California National Primate Research Center. Dec. 12-13, ... California National Primate Research Center. Gilead Sciences. Norbert Bischofberger John Desja ...

| PowerPoint PPT presentation | free to view

SelfAdministration of Cocaine in Naive Rhesus Macaque PowerPoint PPT Presentation

SelfAdministration of Cocaine in Naive Rhesus Macaque - The percentage of eighth graders reporting crack use at least once in their ... Past-year use of crack also rose slightly among this group, although no changes ...

The percentage of eighth graders reporting crack use at least once in their ... Past-year use of crack also rose slightly among this group, although no changes ...

| PowerPoint PPT presentation | free to view

Representation of movement in near extra-personal space in macaque area VIP PowerPoint PPT Presentation

Representation of movement in near extra-personal space in macaque area VIP - Intelligence, Cognition, and Adaptive Behavior why machines? building intelligent machines always reflects our progress in understanding of nature: For instance, we ...

Intelligence, Cognition, and Adaptive Behavior why machines? building intelligent machines always reflects our progress in understanding of nature: For instance, we ...

| PowerPoint PPT presentation | free to view

Risk and Resilience: Early Manipulation of Macaque Social Experience and Persistent Behavioral and N PowerPoint PPT Presentation

Risk and Resilience: Early Manipulation of Macaque Social Experience and Persistent Behavioral and N - Four components of early macaque development : Stages of social development. Macaque temperament and biological correlates. ... Macaque Social Development ...

Four components of early macaque development : Stages of social development. Macaque temperament and biological correlates. ... Macaque Social Development ...

| PowerPoint PPT presentation | free to view

Temporal dynamics of a neural solution to the aperture problem in visual area MT of macaque brain PowerPoint PPT Presentation

Temporal dynamics of a neural solution to the aperture problem in visual area MT of macaque brain - ... of a neural solution to the aperture problem in visual area MT of macaque brain ... Train macaques to fixate on small red square for liquid reward ...

... of a neural solution to the aperture problem in visual area MT of macaque brain ... Train macaques to fixate on small red square for liquid reward ...

| PowerPoint PPT presentation | free to download

Infant Handling and Maternal Response in Japanese Macaques PowerPoint PPT Presentation

Infant Handling and Maternal Response in Japanese Macaques - All types of social interactions as well as the maternal response to such ... various infant social interactions directed to the infant in relation to infant ...

All types of social interactions as well as the maternal response to such ... various infant social interactions directed to the infant in relation to infant ...

| PowerPoint PPT presentation | free to download

Humoral Immune Responses Have No Significant Impact in Controlling Viremia During Rhesus Macaque Inf PowerPoint PPT Presentation

Humoral Immune Responses Have No Significant Impact in Controlling Viremia During Rhesus Macaque Inf - Humoral Immune Responses Have No Significant Impact in Controlling Viremia ... To examine the impact of humoral immune responses on the SIVsmm215 replication ...

Humoral Immune Responses Have No Significant Impact in Controlling Viremia ... To examine the impact of humoral immune responses on the SIVsmm215 replication ...

| PowerPoint PPT presentation | free to view

USING GLASS PATTERNS AND fMRI TO IDENTIFY AREAS THAT PROCESS GLOBAL FORM IN MACAQUE VISUAL CORTEX. PowerPoint PPT Presentation

USING GLASS PATTERNS AND fMRI TO IDENTIFY AREAS THAT PROCESS GLOBAL FORM IN MACAQUE VISUAL CORTEX. - ... TO IDENTIFY AREAS THAT PROCESS GLOBAL FORM IN MACAQUE VISUAL CORTEX. We set out to locate areas of the macaque brain involved in processing form using fMRI. ...

... TO IDENTIFY AREAS THAT PROCESS GLOBAL FORM IN MACAQUE VISUAL CORTEX. We set out to locate areas of the macaque brain involved in processing form using fMRI. ...

| PowerPoint PPT presentation | free to download

DNA and the Genetic Code PowerPoint PPT Presentation

DNA and the Genetic Code - Macaque -- ACCCGCACCTCATTCCTACATCAATGAGTGGCTCCAAATAGACCTGGGGG ... Macaque AGGAGAAGATCGTGAGGGGCATCATCATTCAGGGTGGGAAGCACCGAGAG ... Macaque ...

Macaque -- ACCCGCACCTCATTCCTACATCAATGAGTGGCTCCAAATAGACCTGGGGG ... Macaque AGGAGAAGATCGTGAGGGGCATCATCATTCAGGGTGGGAAGCACCGAGAG ... Macaque ...

| PowerPoint PPT presentation | free to view

Impact of NPACI on Computational Anatomy Neuroscience Thrust UCSD 2001 PowerPoint PPT Presentation

Impact of NPACI on Computational Anatomy Neuroscience Thrust UCSD 2001 - Macaque Human. Macaque & Human. Anatomy. With. Function. Macaque parietal areas (VE), fMRI attention task (Corbetta,VE), Visible Human ...

Macaque Human. Macaque & Human. Anatomy. With. Function. Macaque parietal areas (VE), fMRI attention task (Corbetta,VE), Visible Human ...

| PowerPoint PPT presentation | free to view

Herpes Bvirus Cercopithecine herpesvirus 1 PowerPoint PPT Presentation

Herpes Bvirus Cercopithecine herpesvirus 1 - It is carried asymptomatically in macaques. ... tissues or fluids of macaques. Ocular, oral, or genital secretions ... Limit direct contact with awake macaques ...

It is carried asymptomatically in macaques. ... tissues or fluids of macaques. Ocular, oral, or genital secretions ... Limit direct contact with awake macaques ...

| PowerPoint PPT presentation | free to view

Why and How to Measure Proliferative Capacity PowerPoint PPT Presentation

Why and How to Measure Proliferative Capacity - Flow methods for characterizing proliferating cells ... Study of T Cell Dynamics in Rhesus Macaque ... Summary: T cell proliferation/turnover in healthy macaques ...

Flow methods for characterizing proliferating cells ... Study of T Cell Dynamics in Rhesus Macaque ... Summary: T cell proliferation/turnover in healthy macaques ...

| PowerPoint PPT presentation | free to view

Passive Immunization PowerPoint PPT Presentation

Passive Immunization - replicates in rhesus macaque PBMC. results in persistent infection in adult macaques. ... All nmAb-treated macaques were completely protected from infection ...

replicates in rhesus macaque PBMC. results in persistent infection in adult macaques. ... All nmAb-treated macaques were completely protected from infection ...

| PowerPoint PPT presentation | free to view

Neural codes and spiking models PowerPoint PPT Presentation

Neural codes and spiking models - Title: Representation of movement in near extra-personal space in macaque area VIP Author: Allg. Zool & Neurobiol. Last modified by - Created Date

Title: Representation of movement in near extra-personal space in macaque area VIP Author: Allg. Zool & Neurobiol. Last modified by - Created Date

| PowerPoint PPT presentation | free to view

OSA 98 talk - macaque monkey. Direction tuning. Orientation tuning. Orthogonal ... Typical MT neuron, macaque monkey. Multiple motions. Medical University of L beck ...

macaque monkey. Direction tuning. Orientation tuning. Orthogonal ... Typical MT neuron, macaque monkey. Multiple motions. Medical University of L beck ...

| PowerPoint PPT presentation | free to view

Reduced Viremia Following Immunotherapy of SIV with Peptide Pulsed Blood PowerPoint PPT Presentation

Reduced Viremia Following Immunotherapy of SIV with Peptide Pulsed Blood - Macaque efficacy study. tat. Pol. Env. SIVmac239. b: 'OPAL (All)' - broad. Vif. Vpx. Vpr. Gag ... Pigtail macaque/SIVmac251 model * 36 macaques. Week after ...

Macaque efficacy study. tat. Pol. Env. SIVmac239. b: 'OPAL (All)' - broad. Vif. Vpx. Vpr. Gag ... Pigtail macaque/SIVmac251 model * 36 macaques. Week after ...

| PowerPoint PPT presentation | free to view

Dopamine, Craving, the Cerebellar Vermis, and Ibogaine PowerPoint PPT Presentation

Dopamine, Craving, the Cerebellar Vermis, and Ibogaine - The Brain Imaging Center, McLean Hospital, ... immunoreactivity (DAT-IR) in macaque cerebellar midline (anterior- and posterior ... Macaque. Summary So Far...

The Brain Imaging Center, McLean Hospital, ... immunoreactivity (DAT-IR) in macaque cerebellar midline (anterior- and posterior ... Macaque. Summary So Far...

| PowerPoint PPT presentation | free to view

Compartmentalized HIV and SIV Populations in the Central Nervous System Are Associated with Neuropat PowerPoint PPT Presentation

Compartmentalized HIV and SIV Populations in the Central Nervous System Are Associated with Neuropat - Development and Characterization of an SIV/macaque Model ... CSF MCP-1 Levels are Elevated in Macaque C002 ... SIV/Macaque Model Summary. Two patterns of ...

Development and Characterization of an SIV/macaque Model ... CSF MCP-1 Levels are Elevated in Macaque C002 ... SIV/Macaque Model Summary. Two patterns of ...

| PowerPoint PPT presentation | free to view

Trophoblast invasion PowerPoint PPT Presentation

Trophoblast invasion - Macaque - Yes. Mouse No. Rat Yes. Field vole - No. Hamster - Yes. Interstitial. Human Yes. Macaque - Yes. Mouse No. Rat No. Field vole - Yes. Hamster - No ...

Macaque - Yes. Mouse No. Rat Yes. Field vole - No. Hamster - Yes. Interstitial. Human Yes. Macaque - Yes. Mouse No. Rat No. Field vole - Yes. Hamster - No ...

| PowerPoint PPT presentation | free to view

Molecular Evolution: Selection PowerPoint PPT Presentation

Molecular Evolution: Selection - the ratio between the number of non-synonymous substitutions (KA) and synonymous ... O' denotes orangutan, 'M' macaque, 'OGCH' the orangutan gorilla chimpanzee human ...

the ratio between the number of non-synonymous substitutions (KA) and synonymous ... O' denotes orangutan, 'M' macaque, 'OGCH' the orangutan gorilla chimpanzee human ...

| PowerPoint PPT presentation | free to download

Visual categorization shapes feature selectivity in the primate temporal cortex PowerPoint PPT Presentation

Visual categorization shapes feature selectivity in the primate temporal cortex - Generally: How do we categorize objects? What ... are represented in neurons in the inferior temporal cortex of the macaque? ... Two [happy] macaque monkeys ...

Generally: How do we categorize objects? What ... are represented in neurons in the inferior temporal cortex of the macaque? ... Two [happy] macaque monkeys ...

| PowerPoint PPT presentation | free to download

Organization, development and function of complex brain networks PowerPoint PPT Presentation

Organization, development and function of complex brain networks - The cortical networks of cat and macaque are vulnerable towards the damage of ... Macaque cortex with associated long-range connectivity among areas. ...

The cortical networks of cat and macaque are vulnerable towards the damage of ... Macaque cortex with associated long-range connectivity among areas. ...

| PowerPoint PPT presentation | free to download

Measuring Alcohol and Stress Interactions with Structural and Perfusion MRI PowerPoint PPT Presentation

Measuring Alcohol and Stress Interactions with Structural and Perfusion MRI - Measuring Alcohol and Stress Interactions with Structural and ... young rhesus macaque. cynomolgus macaque. Have applied EM Segmenter in Slicer 2.x as well. ...

Measuring Alcohol and Stress Interactions with Structural and ... young rhesus macaque. cynomolgus macaque. Have applied EM Segmenter in Slicer 2.x as well. ...

| PowerPoint PPT presentation | free to view

Neural Computation PowerPoint PPT Presentation

Neural Computation - Mean spike count and variance of 94 cells (MT macaque) under different stimulus conditions. ... MT and V1 macaque. Shortcomings of Poisson model ...

Mean spike count and variance of 94 cells (MT macaque) under different stimulus conditions. ... MT and V1 macaque. Shortcomings of Poisson model ...

| PowerPoint PPT presentation | free to view

The Influence of Cytopathic and Antigenic Simian Immunodeficiency Virus on AIDS Progression (Kimata J.T. et al.) PowerPoint PPT Presentation

The Influence of Cytopathic and Antigenic Simian Immunodeficiency Virus on AIDS Progression (Kimata J.T. et al.) - Viruses that evolve in macaques infected with an M-tropic, NSI SIV clone derived ... co-cultivating in stimulated macaque peripheral blood mononuclear cells (PBMCs) ...

Viruses that evolve in macaques infected with an M-tropic, NSI SIV clone derived ... co-cultivating in stimulated macaque peripheral blood mononuclear cells (PBMCs) ...

| PowerPoint PPT presentation | free to view

HIV Vaccine and Vaccines in HIV infection PowerPoint PPT Presentation

HIV Vaccine and Vaccines in HIV infection - Rhesus Macaque (Rhesus Monkey) Our victim. Rhesus Monkey. July ... macaques are native to Asia and do NOT carry their own strain of SIV. So Rhesus macaques can ...

Rhesus Macaque (Rhesus Monkey) Our victim. Rhesus Monkey. July ... macaques are native to Asia and do NOT carry their own strain of SIV. So Rhesus macaques can ...

| PowerPoint PPT presentation | free to view

Reinforcing Management Promoting Cooperation PowerPoint PPT Presentation

Reinforcing Management Promoting Cooperation - Reinforcing Management. Promoting Cooperation. YANG Liuqing ... Tibetan macaque. Purposes of the English Version. Let China popular science known to the world. ...

Reinforcing Management. Promoting Cooperation. YANG Liuqing ... Tibetan macaque. Purposes of the English Version. Let China popular science known to the world. ...

| PowerPoint PPT presentation | free to download

EVC - Amara Lab / Pragati Nigam. CD3 CD4 CD25 subsets from non-infected rhesus macaque ... rhesus macaque PBMC. for. CD4 CD25 CD4-CD25 CD4 CD25- CD4- CD25- EVC ...

Amara Lab / Pragati Nigam. CD3 CD4 CD25 subsets from non-infected rhesus macaque ... rhesus macaque PBMC. for. CD4 CD25 CD4-CD25 CD4 CD25- CD4- CD25- EVC ...

| PowerPoint PPT presentation | free to download

The role of virus and host factors in HIV transmission PowerPoint PPT Presentation

The role of virus and host factors in HIV transmission - The TRIM5 of macaques blocks HIV-1 replication ... proteins that naturally block HIV-1, such as TRIM5a found in macaque monkeys. ...

The TRIM5 of macaques blocks HIV-1 replication ... proteins that naturally block HIV-1, such as TRIM5a found in macaque monkeys. ...

| PowerPoint PPT presentation | free to view

Dynamical Systems Analysis for Systems of Spiking Neurons PowerPoint PPT Presentation

Dynamical Systems Analysis for Systems of Spiking Neurons - Resting Potential VRest assumed to be 0. ... Spike generated when V reaches VThreshold ... (Area V1 of Macaque Monkey) Source: Dr. Wyeth Bair, CNS, NYU ...

Resting Potential VRest assumed to be 0. ... Spike generated when V reaches VThreshold ... (Area V1 of Macaque Monkey) Source: Dr. Wyeth Bair, CNS, NYU ...

| PowerPoint PPT presentation | free to download

Activity Dependent Conductances: An PowerPoint PPT Presentation

Activity Dependent Conductances: An - Input Layer of Primary Visual Cortex (V1) for Macaque Monkey. Modeled at : ... Visual Pathway: Retina -- LGN -- V1 -- Beyond. Our Model ...

Input Layer of Primary Visual Cortex (V1) for Macaque Monkey. Modeled at : ... Visual Pathway: Retina -- LGN -- V1 -- Beyond. Our Model ...

| PowerPoint PPT presentation | free to download

Observational%20Learning PowerPoint PPT Presentation

Observational%20Learning - A change in behaviour due to the experience of observing a model ... Macaque monkey with electrodes in premotor cortex. Published in 1996. Locations in Humans ...

A change in behaviour due to the experience of observing a model ... Macaque monkey with electrodes in premotor cortex. Published in 1996. Locations in Humans ...

| PowerPoint PPT presentation | free to download

Bioinformatics: Applications PowerPoint PPT Presentation

Bioinformatics: Applications - Gorilla. Macaque. Rooted Tree. Unrooted Tree. In an unrooted tree, the edges are ' ... Gorilla ..AGCATAGGGGTCAGGGGAAAGGCT.. Human ..AGCAAAAGGGTCAGGGGAAGGGGA. ...

Gorilla. Macaque. Rooted Tree. Unrooted Tree. In an unrooted tree, the edges are ' ... Gorilla ..AGCATAGGGGTCAGGGGAAAGGCT.. Human ..AGCAAAAGGGTCAGGGGAAGGGGA. ...

| PowerPoint PPT presentation | free to view

Introduction to Environmental Philosophy rand3 SFES 1214 PowerPoint PPT Presentation

Introduction to Environmental Philosophy rand3 SFES 1214 - Part 2: Exploring environmental ethics in the human-macaque conflict ... Stop exporting the macaques. Nearly 80% of urban macaques found to be infected with ...

Part 2: Exploring environmental ethics in the human-macaque conflict ... Stop exporting the macaques. Nearly 80% of urban macaques found to be infected with ...

| PowerPoint PPT presentation | free to view

Evolution and Cognition: the origins of human intelligence Mind, Brain and Behaviour Lecture 9 PowerPoint PPT Presentation

Evolution and Cognition: the origins of human intelligence Mind, Brain and Behaviour Lecture 9 - Pre-motor cortex F5 and Superior Temporal Sulcus (STS) in macaque monkeys. F5 in macaques linked to Broca's area in humans- bridge between performing and ...

Pre-motor cortex F5 and Superior Temporal Sulcus (STS) in macaque monkeys. F5 in macaques linked to Broca's area in humans- bridge between performing and ...

| PowerPoint PPT presentation | free to view

Human Herpesviruses: PowerPoint PPT Presentation

Human Herpesviruses: - 'Around here, it takes all the running you can do just to stay ... virus infection occurs naturally in Macaque monkeys, most with NO obvious signs of infection. ...

'Around here, it takes all the running you can do just to stay ... virus infection occurs naturally in Macaque monkeys, most with NO obvious signs of infection. ...

| PowerPoint PPT presentation | free to download

Autism And Mirror Neurons PowerPoint PPT Presentation

Autism And Mirror Neurons - First discovered in Macaque monkeys found to: Mediate imitation. Basis of action understanding ... Macaque brain that were active during the presentation of a ...

First discovered in Macaque monkeys found to: Mediate imitation. Basis of action understanding ... Macaque brain that were active during the presentation of a ...

| PowerPoint PPT presentation | free to view

Creation of topographical maps and modeling of brain plasticity. PowerPoint PPT Presentation

Creation of topographical maps and modeling of brain plasticity. - What is to be explained in visual map formation? Assumptions and types of models ... Optical recordings from large surfaces of macaque visual systems. ...

What is to be explained in visual map formation? Assumptions and types of models ... Optical recordings from large surfaces of macaque visual systems. ...

| PowerPoint PPT presentation | free to download

Michael Arbib: CS664 PowerPoint PPT Presentation

Michael Arbib: CS664 - Visual Control of Grasping in Macaque Monkey. F5 - grasp. commands in. premotor cortex ... What does it take for (monkey) MNS to work? Visual Input: ...

Visual Control of Grasping in Macaque Monkey. F5 - grasp. commands in. premotor cortex ... What does it take for (monkey) MNS to work? Visual Input: ...

| PowerPoint PPT presentation | free to download

Cortical Pathways for Visual Perception PowerPoint PPT Presentation

Cortical Pathways for Visual Perception - Cortical Pathways for Visual Perception. Output from occipital ... Superior longitudinal fasciculus ... on neuronal specificity to faces in the macaque ...

Cortical Pathways for Visual Perception. Output from occipital ... Superior longitudinal fasciculus ... on neuronal specificity to faces in the macaque ...

| PowerPoint PPT presentation | free to view

The Roots of Empathy and Childrens SocialEmotional Competence From Theory to Practice to Effectivene PowerPoint PPT Presentation

The Roots of Empathy and Childrens SocialEmotional Competence From Theory to Practice to Effectivene - The Roots of Empathy and Children's Social-Emotional Competence ... Macaque Brain. Human Brain. Empathy: Social Interactional (or Relational) View ...

The Roots of Empathy and Children's Social-Emotional Competence ... Macaque Brain. Human Brain. Empathy: Social Interactional (or Relational) View ...

| PowerPoint PPT presentation | free to view

The control of movement can be studied PowerPoint PPT Presentation

The control of movement can be studied - Stop Signal Reaction Time (SSRT) time needed to cancel a ... Hanes DP and Schall JD (1995) Countermanding saccades in macaque.Visual Neuroscience 12:929-37` ...

Stop Signal Reaction Time (SSRT) time needed to cancel a ... Hanes DP and Schall JD (1995) Countermanding saccades in macaque.Visual Neuroscience 12:929-37` ...

| PowerPoint PPT presentation | free to download

Simple Null Hypothesis PowerPoint PPT Presentation

Simple Null Hypothesis - Data are only a member of a family of processes. Example: ... DVS plot : Juvenile Macaque. DVS plot : Mature Macaque. Surrogate Analysis: DVS plot ...

Data are only a member of a family of processes. Example: ... DVS plot : Juvenile Macaque. DVS plot : Mature Macaque. Surrogate Analysis: DVS plot ...

| PowerPoint PPT presentation | free to view

PALEONTOLOGY: KEY QUESTIONS PowerPoint PPT Presentation

PALEONTOLOGY: KEY QUESTIONS - What are the features of the primate skeleton, and how can our knowledge of them ... Macaque: Generalized quadrupedalism. Gorilla: Semi-erect knuckle walking ...

What are the features of the primate skeleton, and how can our knowledge of them ... Macaque: Generalized quadrupedalism. Gorilla: Semi-erect knuckle walking ...

| PowerPoint PPT presentation | free to download

MAVID: Constrained Ancestral Alignment of Multiple Sequence PowerPoint PPT Presentation

MAVID: Constrained Ancestral Alignment of Multiple Sequence - Practical for sequence for alignments of large genomic region ... cat, chicken, chimp, cow, dog, dunnart, fugu, hedgehog, horse, lemur, macaque, ...

Practical for sequence for alignments of large genomic region ... cat, chicken, chimp, cow, dog, dunnart, fugu, hedgehog, horse, lemur, macaque, ...

| PowerPoint PPT presentation | free to download

Nonlinearity in Primary Visual Cortex PowerPoint PPT Presentation

Nonlinearity in Primary Visual Cortex - ... texture patterns in area V1 of the alert macaque monkey. J Neurophys. ... stopping and the aperture problem: Two-dimensional motion signals in macaque V1. ...

... texture patterns in area V1 of the alert macaque monkey. J Neurophys. ... stopping and the aperture problem: Two-dimensional motion signals in macaque V1. ...

| PowerPoint PPT presentation | free to view

Nonhuman Primates: Taxonomy, Conservation, and Research Use PowerPoint PPT Presentation

Nonhuman Primates: Taxonomy, Conservation, and Research Use - Innermost digit of at least 1 pair of extremities opposable. Well ... Wild-caught cynomolgus and pig-tail macaques. Philippines (SICONBREC. information) 1994 ...

Innermost digit of at least 1 pair of extremities opposable. Well ... Wild-caught cynomolgus and pig-tail macaques. Philippines (SICONBREC. information) 1994 ...

| PowerPoint PPT presentation | free to view

The Selective Tuning Model of Visual Attention PowerPoint PPT Presentation

The Selective Tuning Model of Visual Attention - A Neural Model for Detecting and Labeling Motion Patterns in Image ... Macaque Brain. Blue: motion perception pathway. Green: object recognition pathway ...

A Neural Model for Detecting and Labeling Motion Patterns in Image ... Macaque Brain. Blue: motion perception pathway. Green: object recognition pathway ...

| PowerPoint PPT presentation | free to view

Primary HIV1 Infection PowerPoint PPT Presentation

Primary HIV1 Infection - Understand the importance of Primary HIV from a historical and ... Intravaginal macaque/SIV model: By 24 hours, SIV detected in the vaginal dendritic cells. ...

Understand the importance of Primary HIV from a historical and ... Intravaginal macaque/SIV model: By 24 hours, SIV detected in the vaginal dendritic cells. ...

| PowerPoint PPT presentation | free to view

The influence of Sperm Competition on positive selection in primate testes PowerPoint PPT Presentation

The influence of Sperm Competition on positive selection in primate testes - Provides a theoretical evolutionary model also called the ... Macaque (Macaca mulatta) Multimale-multifemale. Orangutan (Pongo pygmaeus ) Single female ...

Provides a theoretical evolutionary model also called the ... Macaque (Macaca mulatta) Multimale-multifemale. Orangutan (Pongo pygmaeus ) Single female ...

| PowerPoint PPT presentation | free to view

Attention - Only information that passed the filter received further ... (Macaque monkey) Signal. Analysis. Receptive Field. Attention Effects in. Single Neuron Responses ...

Only information that passed the filter received further ... (Macaque monkey) Signal. Analysis. Receptive Field. Attention Effects in. Single Neuron Responses ...

| PowerPoint PPT presentation | free to download

Macaque PowerPoint PPT Presentations