Macaque PowerPoint PPT Presentations
All Time
Recommended
Modeling Primary Visual Cortex (of Macaque) David W. McLaughlin Courant Institute & Center for Neural Science New York University dmac@courant.nyu.edu
| free to download
3 main types of predator, and 3 alarm calls. Eagle gets a Cough, Snake gets a Chutter ... So monkeys respond to acoustic signals, not just to signaller's ...
| free to view
Not in squirrel monkey - innate. Perhaps in X-fostered Japanese & rhesus ... e.g., snake track on ground, or antelope carcass stored in tree (which signals ...
| free to view
The percentage of eighth graders reporting crack use at least once in their ... Past-year use of crack also rose slightly among this group, although no changes ...
| free to view
California National Primate Research Center. Dec. 12-13, ... California National Primate Research Center. Gilead Sciences. Norbert Bischofberger John Desja ...
| free to view
71 MT units from 12 macaque monkeys. All receptive fields were ... tuning bandwidth decreases substantially, owing to maintained inhibition from remote cells. ...
| free to view
Intelligence, Cognition, and Adaptive Behavior why machines? building intelligent machines always reflects our progress in understanding of nature: For instance, we ...
| free to view
Four components of early macaque development : Stages of social development. Macaque temperament and biological correlates. ... Macaque Social Development ...
| free to view
All types of social interactions as well as the maternal response to such ... various infant social interactions directed to the infant in relation to infant ...
| free to download
... of a neural solution to the aperture problem in visual area MT of macaque brain ... Train macaques to fixate on small red square for liquid reward ...
| free to download
Humoral Immune Responses Have No Significant Impact in Controlling Viremia ... To examine the impact of humoral immune responses on the SIVsmm215 replication ...
| free to view
... TO IDENTIFY AREAS THAT PROCESS GLOBAL FORM IN MACAQUE VISUAL CORTEX. We set out to locate areas of the macaque brain involved in processing form using fMRI. ...
| free to download
Macaque -- ACCCGCACCTCATTCCTACATCAATGAGTGGCTCCAAATAGACCTGGGGG ... Macaque AGGAGAAGATCGTGAGGGGCATCATCATTCAGGGTGGGAAGCACCGAGAG ... Macaque ...
| free to view
Macaque Human. Macaque & Human. Anatomy. With. Function. Macaque parietal areas (VE), fMRI attention task (Corbetta,VE), Visible Human ...
| free to view
replicates in rhesus macaque PBMC. results in persistent infection in adult macaques. ... All nmAb-treated macaques were completely protected from infection ...
| free to view
It is carried asymptomatically in macaques. ... tissues or fluids of macaques. Ocular, oral, or genital secretions ... Limit direct contact with awake macaques ...
| free to view
Macaque efficacy study. tat. Pol. Env. SIVmac239. b: 'OPAL (All)' - broad. Vif. Vpx. Vpr. Gag ... Pigtail macaque/SIVmac251 model * 36 macaques. Week after ...
| free to view
Development and Characterization of an SIV/macaque Model ... CSF MCP-1 Levels are Elevated in Macaque C002 ... SIV/Macaque Model Summary. Two patterns of ...
| free to view
macaque monkey. Direction tuning. Orientation tuning. Orthogonal ... Typical MT neuron, macaque monkey. Multiple motions. Medical University of L beck ...
| free to view
The Brain Imaging Center, McLean Hospital, ... immunoreactivity (DAT-IR) in macaque cerebellar midline (anterior- and posterior ... Macaque. Summary So Far...
| free to view
Rhesus Macaque (Rhesus Monkey) Our victim. Rhesus Monkey. July ... macaques are native to Asia and do NOT carry their own strain of SIV. So Rhesus macaques can ...
| free to view
Flow methods for characterizing proliferating cells ... Study of T Cell Dynamics in Rhesus Macaque ... Summary: T cell proliferation/turnover in healthy macaques ...
| free to view
Part 2: Exploring environmental ethics in the human-macaque conflict ... Stop exporting the macaques. Nearly 80% of urban macaques found to be infected with ...
| free to view
The cortical networks of cat and macaque are vulnerable towards the damage of ... Macaque cortex with associated long-range connectivity among areas. ...
| free to download
Generally: How do we categorize objects? What ... are represented in neurons in the inferior temporal cortex of the macaque? ... Two [happy] macaque monkeys ...
| free to download
Mean spike count and variance of 94 cells (MT macaque) under different stimulus conditions. ... MT and V1 macaque. Shortcomings of Poisson model ...
| free to view
The TRIM5 of macaques blocks HIV-1 replication ... proteins that naturally block HIV-1, such as TRIM5a found in macaque monkeys. ...
| free to view
Macaque - Yes. Mouse No. Rat Yes. Field vole - No. Hamster - Yes. Interstitial. Human Yes. Macaque - Yes. Mouse No. Rat No. Field vole - Yes. Hamster - No ...
| free to view
Measuring Alcohol and Stress Interactions with Structural and ... young rhesus macaque. cynomolgus macaque. Have applied EM Segmenter in Slicer 2.x as well. ...
| free to view
Viruses that evolve in macaques infected with an M-tropic, NSI SIV clone derived ... co-cultivating in stimulated macaque peripheral blood mononuclear cells (PBMCs) ...
| free to view
First discovered in Macaque monkeys found to: Mediate imitation. Basis of action understanding ... Macaque brain that were active during the presentation of a ...
| free to view
Amara Lab / Pragati Nigam. CD3 CD4 CD25 subsets from non-infected rhesus macaque ... rhesus macaque PBMC. for. CD4 CD25 CD4-CD25 CD4 CD25- CD4- CD25- EVC ...
| free to download
Data are only a member of a family of processes. Example: ... DVS plot : Juvenile Macaque. DVS plot : Mature Macaque. Surrogate Analysis: DVS plot ...
| free to view
Pre-motor cortex F5 and Superior Temporal Sulcus (STS) in macaque monkeys. F5 in macaques linked to Broca's area in humans- bridge between performing and ...
| free to view
... texture patterns in area V1 of the alert macaque monkey. J Neurophys. ... stopping and the aperture problem: Two-dimensional motion signals in macaque V1. ...
| free to view
Japanese Macaque. a.k.a.: Snow Monkeys. Koshima, 1953. Japanese researchers leave sweet potatoes on a beach for a troop of macaques ...
| free to view
Color Processing in the Macaque Striate Cortex: Relationships to Ocular ... organized representation of colour in macaque cortical area V2. Nature 412:535 ...
| free to view
Adult, rhesus macaque from which SFV has been well-characterized (biologically and molecularly) ... Juvenile, rhesus macaques will be obtained from a known ' ...
| free to download
Title: Representation of movement in near extra-personal space in macaque area VIP Author: Allg. Zool & Neurobiol. Last modified by - Created Date
| free to view
Gorilla. Macaque. Rooted Tree. Unrooted Tree. In an unrooted tree, the edges are ' ... Gorilla ..AGCATAGGGGTCAGGGGAAAGGCT.. Human ..AGCAAAAGGGTCAGGGGAAGGGGA. ...
| free to view
the ratio between the number of non-synonymous substitutions (KA) and synonymous ... O' denotes orangutan, 'M' macaque, 'OGCH' the orangutan gorilla chimpanzee human ...
| free to download
Reinforcing Management. Promoting Cooperation. YANG Liuqing ... Tibetan macaque. Purposes of the English Version. Let China popular science known to the world. ...
| free to download
Input Layer of Primary Visual Cortex (V1) for Macaque Monkey. Modeled at : ... Visual Pathway: Retina -- LGN -- V1 -- Beyond. Our Model ...
| free to download
HIV-1 fitness costs associated with mutations to escape immune pressure ... SIV studies in macaques ... SIV-macaque model. Smith et al. J Biol Chem 2003 278:44816-25 ...
| free to view
Cortical Pathways for Visual Perception. Output from occipital ... Superior longitudinal fasciculus ... on neuronal specificity to faces in the macaque ...
| free to view
Resting Potential VRest assumed to be 0. ... Spike generated when V reaches VThreshold ... (Area V1 of Macaque Monkey) Source: Dr. Wyeth Bair, CNS, NYU ...
| free to download
The Roots of Empathy and Children's Social-Emotional Competence ... Macaque Brain. Human Brain. Empathy: Social Interactional (or Relational) View ...
| free to view
Provides a theoretical evolutionary model also called the ... Macaque (Macaca mulatta) Multimale-multifemale. Orangutan (Pongo pygmaeus ) Single female ...
| free to view
A change in behaviour due to the experience of observing a model ... Macaque monkey with electrodes in premotor cortex. Published in 1996. Locations in Humans ...
| free to download
Practical for sequence for alignments of large genomic region ... cat, chicken, chimp, cow, dog, dunnart, fugu, hedgehog, horse, lemur, macaque, ...
| free to download
Functional organization of the brain reflects adaptation to environment ... Corroborating macaque findings on the 'what' and 'where' ...
| free to view
What is to be explained in visual map formation? Assumptions and types of models ... Optical recordings from large surfaces of macaque visual systems. ...
| free to download
Only information that passed the filter received further ... (Macaque monkey) Signal. Analysis. Receptive Field. Attention Effects in. Single Neuron Responses ...
| free to download
Cone wavelength sensitivity functions overlap each other. ... Color Processing in the Macaque Striate Cortex: Relationships to Ocular ...
| free to view
Mutational changes (errors) in genetic transmission are ... MACAQUE. OWL MONKEY. Newick format. Molecular Phylogeny. Tree building methods. Molecular Phylogeny ...
| free to view
