Motifml PowerPoint PPT Presentations

All Time
Show:
Recommended
Sort by:
Using DAML format for representation and integration of complex gene networks: implications in novel drug discovery PowerPoint PPT Presentation
Using DAML format for representation and integration of complex gene networks: implications in novel drug discovery - ... eXtensible Markup Language (XML) is becoming a key component in data exchange ... schemas through ontology-based models for integration of complex genetic ...
... eXtensible Markup Language (XML) is becoming a key component in data exchange ... schemas through ontology-based models for integration of complex genetic ...
| PowerPoint PPT presentation | free to download
MotifML PowerPoint PPT Presentation
MotifML - bovine GCTTGAATTAAATAGGATTAAAGGC TTATCAGGGCTGGGAGCTACACCCC -AACTCCTGAGTTTAGCCCCA ... 85%. The Genbank entries for human, bovine, and mouse are X53044, M32733, and ...
bovine GCTTGAATTAAATAGGATTAAAGGC TTATCAGGGCTGGGAGCTACACCCC -AACTCCTGAGTTTAGCCCCA ... 85%. The Genbank entries for human, bovine, and mouse are X53044, M32733, and ...
| PowerPoint PPT presentation | free to download


Home About Us Terms and Conditions Privacy Policy Contact Us
Copyright 2024 CrystalGraphics, Inc. — All rights Reserved. PowerShow.com is a trademark of CrystalGraphics, Inc.
motifml — Search results on PowerShow.com