Analysis of gene expression by real time PCR

1
Analysis of gene expression by real time PCR

• Analysis of real time PCR data

2
Broad and Long Term Objective
To characterize the expression of the genes
encoding Ribulose 1-5 bisphosphate carboxylase
oxygenase-3 (RBCS3) and Chlorophyll A/B binding
protein-1b (Cab-1b) in the leaves of tomato
plants grown under continuous light or subjected
to 24 hr, 48 hr, or 72 hr in complete darkness.
3
Research Plan
RNA Isolation from tomato leaves (continuous
light or 24-72 hr darkness)
RNA Electrophoresis
cDNA synthesis
RBCS3 and Cab-1b transcript quantitation by real
time PCR
Analysis of real time PCR data
4
Todays Laboratory Objective

• To analyze your data output from the iCycler,
• allowing you to determine
• Specificity of RBCS3 or Cab-1b amplification
• Relative quantitation of RBCS3 or Cab-1b
• transcript levels in light- vs. dark-grown
  tomato
• plants

5
Output data Amplification plot
C1
B1
Ct Table
Ct Identifier
Etc.
Threshold
Relative fluorescence units
6
Output data Amplification plot
Wednesday Lab, Group 9
7
Operator variability in real time PCR
8
Relative quantitation of transcript levels

• Determine average Ct for each treatment (light,
  dark)
• standard deviation
• Determine ?Ct Ct dark Ct light
• Calculate relative difference in transcript
  levels between
• samples (2?Ct)
• Make a histogram to describe the relative
  difference in
• transcript abundance between light
• and dark samples

• Caveats
• Amplification efficiency is rarely 2
• Genomic DNA contamination
• No internal standard transcript

9
Output data Melt curve
Gradual temperature- dependent fluorescence quench
ing
Rapid decrease in fluorescence caused by
denaturation of dsDNA (PCR product)
Melt peak (85.5º C)
Relative fluorescence units
Negative first derivative of fluorescence/temperat
ure
10
Identification of multiple PCR products using a
melt curve
product 2 (Tm 86.9º C)
product 1 (Tm 85.5º C)
primer dimer (Tm 77.0º C)
Under identical solvent conditions, Tm is
determined by G/C content and length of dsDNA
11
Chlorophyll A/B Binding Protein (CAB-1b)
Accession M14443 Coding Sequence
1 atggcagctg ctacaatggc tctttcttcc ccttcatttg
ctggacaggc agtcaaactc 61 tcaccatctg cctcagaaat
ttctggaaat ggaaggatca ctatgagaaa ggctgttgcc 121
aagtccgccc catctagcag cccatggtat ggccctgacc
gtgttaagta cttgggccca 181 ttctctggtg agtccccaag
ctacttgacc ggtgaatttc ctggtgatta cgggtgggat 241
accgctggac tttcagcaga ccctgaaact tttgccaaga
accgtgaact tgaagtgatc 301 cactgcagat gggctatgct
tggtgctctt ggatgtgtct tccctgagct cttggcccgt 361
aatggtgtca agttcggtga ggctgtgtgg ttcaaggccg
gatcccagat cttcagtgaa 421 ggtggacttg actacttggg
caacccaagc ttggtccatg cacaaagcat cttggccatc 481
tgggcttgcc aagttgtgtt gatgggagct gttgagggtt
accgtattgc tggtggacct 541 cttggtgagg ttgtcgaccc
actctaccct ggtggcagct tcgacccatt aggccttgct 601
gaagacccag aggcatttgc tgagctcaag gtaaaggaga
tcaagaacgg tagacttgct 661 atgttctcta tgtttggatt
ctttgttcaa gctattgtca ccggaaaggg tccattggag 721
aaccttgctg atcaccttgc agaccccgta aacaacaatg
cctgggcttt cgccacaaac 781 tttgtccccg gaaaatga

• Start Length Tm GC Seq
• Cab primers
• Left Primer 151 19 59.98 58
  ggccctgaccgtgttaagt
• Right Primer 339 20 59.68 50
  ttggtgctcttggatgtgtc
• Product size 189 52

12
Rubisco Small Subunit (RBCS3) Accession X05986
Coding Sequence
1 atggcttctt cagtaatgtc ctcagcagct gttgccaccc
gcggcaatgg tgcacaagct 61 agcatggttg cacccttcac
tggactcaag tccaccgctt ctttccctgt ttcaaggaag 121
caaaaccttg acattacctc cattgctagc aacggtggaa
gagtcagttg catgcaggtg 181 tggccaccaa ttaacatgaa
gaagtacgag actctgtcgt accttcctga tttgtccgac 241
gagcaattgc tcagcgaaat tgagtaccta ttgaaaaatg
gatgggttcc ttgcttggaa 301 ttcgagactg agcacggatt
tgtgtaccgt gagaaccata agtcaccagg atactacgat 361
ggcagatact ggaccatgtg gaagttgccc atgttcgggt
gcactgatgc aacccaggtc 421 ttggctgagg tgcaggaggc
aaagaaggct tacccacagg catgggtccg tatcatcgga 481
ttcgacaatg ttcgtcaagt gcagtgcatc agtttcatcg
cttacaagcc cgaaggatac 541 taa

• Start Length Tm GC Seq
• Rubisco Set A
• Left Primer 276 20 60.69
  45 AAATGGATGGGTTCCTTGCT
• Right Primer 422 20 59.58
  50 AAGACCTGGGTTGCATCAGT
• Product Size 147 50
• Rubisco Set B
• Left Primer 216 22 59.87 50 GTCGTACCTTCCTGATT
  TGTCC
• Right Primer 375 20 59.96 55 GGTCCAGTATCTGCCA
  TCGT
• Product Size 160 47

13
Expected product melting temperatures
Melting temperature formula, dsDNA
Tm (ºC) 81.5 16.6 log10 (Na/1.0
0.7Na) 0.41(GC) 500/n 1( mismatch)
GC
Product length
0 (no mismatch)
K, not Na is primary cation in the PCR
reaction K 0.0284 M in the PCR reaction for
this melting equation, this is equivalent to
0.114 M Na
Calculated and observed melting temperatures may
vary by 5º C, due to variations in salt
concentration and specific base composition
14
Next Week

• Lab report 3 due Wednesday, Dec. 14,
• 500 pm
• Rubisco (RbcS), chlorophyll a/b-binding
• protein (CAB or Lhc), tomato
• Good luck with finals
• Have a nice winter break