U.S. Animal Detectives Fight Crime in Forensics Lab

1
U.S. Animal Detectives Fight Crime in Forensics
Lab

• Crimes against wildlife include illegal hunting,
  trafficking in endangered species, and producing
  and selling products made from endangered or
  threatened species
• The task of sleuthing and solving these crimes
  falls to a federal laboratory in Ashland, Oregon

2
U.S. Fish and Wildlife ServiceNational Fish and
Wildlife Forensics LaboratoryScotland Yard for
Animals

• Only lab in the world dedicated to solving
  wildlife crimes
• Lab works with federal agents, the 50 state Fish
  and Game Commissions and the roughly 155
  countries that are signatories to CITES the
  Convention on International Trade in Endangered
  Species of Wild Fauna and Flora that oversees
  trade in wild plants and animals
• Every year the lab currently a team of 33
  handles about 900 cases

3
Ken Goddard
4
http//www.lab.fws.gov/labs/index.html
5
Michigan Department of Natural Resources, Law
Enforcement Division Lab Director or Forensic
Specialist Name Dr. Stephen M. Schmitt,
D.V.M. Title Wildlife Veterinarian Address Rose
Lake Wildlife Disease Lab, 8562 East Stoll
Road City East Lansing State/province
Michigan Postal Code 48823 Telephone
517-373-9358 Fax [phone] E-mail
schmitts_at_state.mi.us How many staff work on
wildlife forensics? Three (3) Part Time What
forensic techniques are available at (within)
your laboratory? Cause of death determination,
X-ray, aging techniques, species identification,
some hair, identification and elimination. What
species can be identified with these techniques?
Deer, beaver What new forensic techniques or
other data are being developed within your
laboratory? None. We do the work as a service to
our Law Enforcement Division and fit the work
into our existing schedules, which deal primarily
with wildlife disease and various furbearer and
bear surveys.
6
  Alaska Department of Public Safety Lab Director
or Forensic Specialist Name Jim Wolfe Title
Criminalist III Address Alaska State Crime
Laboratory, 5500 E. Tudor Road City
Anchorage State/province Alaska Postal Code
Telephone [phone] Fax [phone] E-mail
james_wolfe_at_dps.state.ak.us How many staff work
on wildlife forensics? One (1) Part Time What
forensic techniques are available at (within)
your laboratory? The Alaska State Crime Lab
provides Forensic science support for all law
enforcement agencies in the state, including all
wildlife law enforcement agencies. We provide
analyses n most of the standard forensic
techniques, i.e., firearm/tool marks,
fingerprints, trace evidence, shoe prints/tire
tracks, etc., and also provide the following
wildlife specific techniquesspecies
identification of big game hairs, physical
matching of game animal parts and post-mortem
exams. What species can be identified with these
techniques? We no longer do species
identification of meat and blood. The hair
identification can identify hairs from Alaskan
cervids moose, elk, caribou, blacktail
deer. Other comments about your lab or
capabilities We are finding that the requests
for wildlife specific tests are limited (partly
because we have our wildlife officers send meat
and blood evidence for species identification and
DNA directly to the USFWS laboratory). Last year
30 cases came in from Wildlife Law Enforcement
agencies and only three cases requested wildlife
specific tests. The rest of the cases included
analyses such as fingerprints, shoeprints, etc.
7
Examples of evidence items that are sent for
examination

• blood samples (ideally, in a fresh or dried
  condition)
• tissue samples (same as above, only include
  frozen)
• whole carcasses (same as the above, except we're
  rarely that lucky)
• bones
• teeth
• claws
• talons
• tusks
• hair
• hides
• furs
• feathers

• leather goods (purses, shoes, boots...)
• poisons
• Pesticides
• stomach contents (uh huh)
• projectiles (bullets, arrows...)
• weapons (rifles, bows, traps....)
• Asian medicinals (rhino horn pills, tiger bone
  juice...)
• And pretty much anything else you might imagine
  that could have come from (or been made from) an
  animal.

8
Differences between Wildlife Crime and Police
Crime Labs

• The only real difference between a wildlife crime
  lab, and a 'typical' police crime laboratory is
  that the victim is a nonhuman animal.
• Whether they are police or wildlife oriented---do
  two things
• They examine, identify, and compare evidence
  items using a wide range of scientific procedures
  and instruments...
• And in a triangular manner, they attempt to link
  suspect, victim and crime scene with physical
  evidence.

9
Case Histories Molecular Genetic Approaches
10
Mitochondrial Genome

• 17,000 bp, circular in structure
• 37 genes involved in production storage of
  energy
• 13 involved in oxidative phosphorylation
• 22 transfer genes
• 2 ribosomal RNAs

11
Molecular Genetic ApproachesMitochondrial
Control Region also known as the D-loop or the
Hypervariable Region

• Control Region contains the signals that
  control RNA and DNA synthesis
• Hypervariable region termed hypervariable
  because accumulates point mutations at a rate
  5-10 times that of nuclear DNA
• (The high mutation rate of mtDNA is almost
  certainly due to the fact that the mt genome is
  located in close proximity to the respiratory
  machinery of the cell - a known source of potent
  mutagens called oxygen free radicals)
• D-loop early phase of replication forming a loop

12
Detecting the Sale of Meat from Protected Whales

• A global moratorium on commercial harvest of many
  cetacean species was established by the
  International Whaling Commission in 1985
• But whaling never completely stopped whale
  meat continues to be sold in eastern Asia and
  Scandinavia
• Could be from small cetaceans like porpoises or
  dolphins that are still legal to harvest

13
Detecting the Sale of Meat from Protected Whales

• In the early 1990s Baker and Palumbi began
  purchasing whale products from Asian markets
  for mtDNA analysis
• By comparing unknown samples against a reference
  database of cetacean mtDNA sequences, they were
  able to identify species and sometimes geographic
  source of each sample

14
(No Transcript)
15
Detecting the Sale of Meat from Protected Whales

• By 1999, 954 samples of whale meat had been
  purchased in Japan and Korea
• 773 were from whales, 9 were from protected
  whale species (including blue, humpback, fin and
  Brydes whales)
• Samples that were not from whales included
  dolphins, porpoises, sheep and horses
• Demands that whales be genetically typed to
  monitor distribution

16
Web-Based Molecular Identification of Whales,
Dolphins Porpoiseshttp//www.cebl.auckland.ac.n
z9000/
Data Entry

• GAAAATATATATTGTACAATAACCACAAGGCCACAGTATTATGTCCGTAT
  TAAAAATAAC TTATTTTATTGCATACTGTTATGTAACTTGTGCATGTAT
  GTACTCCCACATAACCCATAG TAGTTAGTATTCCCCTGTGAATATGTAT
  ATGTACACATACTATGTATAATTGTGCATTCA
  ATTATCTTCACTACGGAAGTTAAAGCCCGTATTAAATTTTATTAATTTTA
  CATATTACAT AATATTTATTAATAGTACAATAGTACATGTTCTTATGCA
  TCCTCAGGTCATTCTAGACGG AATGACTCTTATGGCCGCTCCATTAGAT
  CACGAGCTTAATCAGCATGCCGCGTGAAACCA
  GCAACCCGCTCGGCAGGGATCCCTCTTCTCGCACCGGGCCCATCAATCGT
  GGGGGTAGCT ATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAG
  GACCATATTAACTTAAAATCG

17
Grouping All Cetaceans Vs3.1, Region mtDNA
control Region (D-Loop)
18
Solving Wildlife Crime

• Lorenzini, R. DNA forensics and the poaching of
  wildlife in Italy A case study. Forensic Science
  International 153218-221.

Wild Boar (Sus scrofa)
19
mtDNA Cytochrome b

• The cytochrome b gene is the most widely used
  gene for phylogenetic work
• Although it evolves slowly in terms of
  non-synonymous substitutions, the rate of
  evolution in silent positions is relatively fast
• Cytochrome b is conserved enough for clarifying
  deeper phylogenetic relationships

20
Cytochrome b

• PCR amplified 307 bp fragment of mtDNA cytchrome
  b
• Restriction digested Hsp92II, Tsp509I, HinfI
• Restriction morphs of bloodstains compared to
  reference samples of cattle, sheep, swine/wild
  boar, goat, chicken, roe deer, red deer, fallow
  deer, brown bear, rabbit, wolf/dog, cat,
  porcupine, and fox
• Species-specific separation except for domestic
  pig and wild boar

21
Restriction of mtDNA D-loopSeparates Pig from
Wild Boar all 3 bloodstains from knife matched
poached animal
Wild Boar
Wild Boar
Pig
Pig
531 bp mtDNA D-loop
Restriction digest AvaII
22
12 Highly Polymorphic Microsatellites Profile
Matching Wild Boar Bood on Knife
23

• Poached animal, 7 of 12 microsatellite loci were
  heterozygous, with a total of 18 alleles
• Comparison of STR (short tandem repeat) patterns
  showed a 75-80 difference in total number of
  alleles
• Probability that two individuals share the same
  12-loci genotype by chance is 1150,000
  acceptable for discriminating an individual
  within a population of a few hundred

Lane Microsatellite 1 Microsatellite 2
Microsatellite 3 . Band a
Band b Band a Band b Band a Band
b Knife 92 100 196
198 200 200 . 1
92 100 196 198
200 200 2 104
106 198 202 204
206 3 108 112
192 194 206 206
. . 30 94 98
196 200 188 190 .
24
Perpetrator was convicted of poaching and of
cruelty to animals based on the forensic evidence
25
Illegal Wildlife Trade

• 1950s
• Endangered by IUCN, Appendix I of CITES
  (Convention on International Trade of Endangered
  Species of Wild Fauna and Flora)
• 1993 Chinese Government stopped trade of tiger
  parts (skin, bone, gall bladder, blood, meat) of
  wild or captive animals

26
Tiger Parts

• Tiger SkinSit on skin to reduce fever.
• Tiger Brain LotionMix with oil and rub on
  body to prevent acne and laziness.
• Tiger Claw AmuletPut in your pocket for
  courage.
• Tiger PenisAdd to soup and take at bedtime
  for virility
• Tiger Hair Repellent
• Burn to drive away centipedes.

• Tiger Eyeball Pills
• Take one a day to prevent convulsions.
• Tiger Gallstone SalveCombine with honey and
  rub on abscesses as needed.
• Tiger Bone PowderDrink with wine at bedtime
  for spring tonic.
• Tiger Whiskers CharmUse as protection against
  bullets.
• Tiger HeartTake three times a day at meals
  for courage and cunning.
• Tiger Tailbone OintmentMix with soap and rub
  on skin rashes.

27
Illegal Wildlife Trade

• On November 25, 2001 a citizen informed
  authorities that a member of a circus in Ningbo
  City was selling tiger meat, bone and other parts
  in a local marketplace
• Police confiscated meat from the only buyer that
  could be located
• The circus was known to have only one tiger on
  visiting the circus facilities the cage had been
  carefully cleaned and only a single unidentified
  hair could be collected

28
Illegal Wildlife TradeComparative material

• Also available for study single plucked hair
  from a tiger at Hangzhou Zoo
• Tiger fecal sample
• Dried skin from tiger, leopard, clouded leopard,
  snow leopard, leopard cat, Asiatic golden cat,
  pala desert cat, muping tufted deer, and domestic
  cow

29
mtDNA Cytochrome b Sequence Data from Genbank
30
Amplification Patterns
Tiger
Non-Tiger
Con
M S H F CH
582 bp 408 bp
31
Results

• D-loop analysis indicated that the meat and the
  hair from the tiger cage had identical sequences
  consistent with coming from the same individual
• Under the wild animal protection laws of China,
  the carcasses of wild and captive animals listed
  on the CITES appendices must be disposed of by
  State authorities
• If carcasses are traded, both buyers and sellers
  are liable for a fine and/or 1-7 years
  imprisonment

32
Development of New Forensic Methodologies

• Shivji, M. et al. 2002. Genetic identification
  of pelagic shark body parts for conservation and
  trade monitoring. Conservation Biology
  161036-1047

Shark Finning is Really, Really Bad, But We Want
the Money Says Disney
33
North Atlantic Sharks

• Dusky
• Blue
• Longfin Mako
• Shortfin Mako
• Porbeagle
• Silky

34
Intergenic spacer between the 5.8S rDNA and 28S
rDNA
9-15 Sequence divergence
35
Amplification Results - 3 Primers
36
Amplification Results 8 Primers