Biochemistry 611 Nucleic Acids 82807 PowerPoint PPT Presentation

presentation player overlay
1 / 44
About This Presentation
Transcript and Presenter's Notes

Title: Biochemistry 611 Nucleic Acids 82807


1
Biochemistry 611 Nucleic Acids8-28-07
2
Chad Wilkerson
  • Post-doctoral fellow in Kevin Sarges lab
  • Dept. Biochemistry, BBSRB Building
  • Lab phone 257-7349
  • Email dcwilk2 _at_ uky.edu

3
Topics To Be Covered
  • Isolating
  • Dissociation/deproteinization
  • Precipitation
  • Quantitating
  • UV absorption
  • Separating
  • Gel electrophoresis Agarose Polyacrylamide
  • Analysis
  • DNA Southern blot, gel shift (EMSA), DNase
    footprinting,
  • ChIP, Promoter pull-down, PCR
  • RNA RT-PCR, RACE, Exon trapping, PCR-based cDNA
    cloning,
  • RNase Protection, northern blot,
    nuclear run-off, primer extension

4
Isolation of Nucleic Acids
  • Two Main Steps for Isolation
  • Dissociation/deproteinization
  • detergent (e.g. SDS, Triton X-100, NP40, CHAPS)
  • An organic (e.g. phenol)
  • DNA ? phenolchloroformisoamyl alcohol (25241)
    at pH 8.0
  • RNA ? acidic pH (below 7) DNA will denature and
    partition into the organic phase
  • Strong electrolyte (e.g. guanidinium
    isothiocyanate Trizol and RNA Stat-60)
  • Precipitation
  • Raising the salt concentration to at least 0.1M
    and adding an alcohol (67 ethanol or 50
    isopropanol) precipitates nucleic acids from the
    aqueous phase
  • Common salts include sodium acetate (NaAc)
    samples brought to 0.3M
  • potassium acetate (KAc)
    samples brought to 0.3M
  • ammonium acetate (NH4Ac)
    samples brought to 2M

5
Isolation of Nucleic Acids
  • Things to keep in mind when isolating nucleic
    acids
  • The integrity of the nucleic acid
  • low and high pH can lead to hydrolysis of nucleic
    acids
  • Excess pipetting or vortexing can shear DNA
  • Any enzyme requirements
  • Specific salts and salt concentrations can
    inhibit enzymes
  • EDTA can inhibit reactions
  • Any functional requirements
  • Some technologies require higher purification of
    nucleic acids

6
Isolation of Nucleic Acids
  • Additional topics related to isolation of nucleic
    acids
  • Tissue disruption
  • Dounce homogenizer
  • Mortar and pestle
  • Sonication
  • Cellular fractionation
  • Examples nuclei, mitochondria, polysomes
  • Chromatographic purifications
  • Examples CsCl gradients, DEAE cellulose, oligo
    dT cellulose

7
(No Transcript)
8
Quantitating Nucleic Acids
Definition of O.D. at A260 refers to the O.D.
reading when the sample in question is diluted to
1.0ml of ddH20 and read in a 1cm quartz cuvette
at 260nm. Nucleic Acids absorb UV light at a
maximum of 260nm There is a direct relationship
between the concentration of a nucleic acid and
its absorption of UV light at 260nm 40 x OD260
of sample concentration of RNA (ug/mL) 50 x
OD260 of sample concentration of DNA (ug/mL) 33
x OD260 of sample concentration of
oligonucleotide (ug/mL) 1 A260 dsDNA 50ug 1
A260 ssDNA 33ug 1 A260 ssRNA 40ug
9
Quantitating Nucleic Acids
The relative purity of nucleic acid samples can
be determined by measuring their absorption at
other wavelengths. 2 main contaminates include
proteins and polysaccarides which have absorption
maximas at 280nm and 230nm respectively. An
uncontaminated RNA sample would have a 230, 260,
280 ratio of 121 An uncontaminated DNA sample
would have a ratio of 11.81
10
Separating Nucleic Acids
  • Gel Electrophoresis
  • Agarose
  • Less analytical
  • Typically used to separate nucleic acids greater
    than 100 bp
  • Concentrations range from 0.4 - 3
  • Buffers commonly used include TAE or TBE
    (non-denaturing) and MOPS-formaldehyde
    (denaturing)
  • Polyacrylamide
  • High resolution capacity
  • Concentrations range from 4 - 20
  • Buffers commonly used include TBE or TTE
    (Tris-taurine EDTA)
  • For denaturing nucleic acids urea is added to a
    final concentration of 7-8M

11
Separating Nucleic Acids
Agarose
Polyacrylamide
Effective Range of Separation of Linear DNA
molecules (kb)
Effective Range of Separation (nucleotides)
Acrylamide ()
Agarose ()
12
Analysis of Nucleic Acids
  • DNA Analysis
  • Southern blot
  • PCR
  • DNAProtein Interactions
  • Gel shift (EMSA)
  • DNase footprinting
  • Chromatin immunoprecipitation (ChIP)
  • Promoter pull- down
  • RNA Analysis
  • RT-PCR
  • Race and Exon Trapping
  • PCR based cDNA cloning
  • northern blot
  • RNase Protection
  • Primer extension

13
Southern Blot
Southern Blot (named after Edward M.
Southern) Commonly used to determine the
molecular weight of a restriction fragment, to
measure relative amounts in different samples and
to locate a particular sequence of DNA within a
complex mixture
  • Basic Protocol
  • Fragment DNA using restriction enzymes
  • Separate fragments by agarose gel electrophoresis
  • DNA fragments are denatured and transferred to
  • a nitrocellulose membrane
  • These membrane-bound fragments are assayed
  • for their ability to hybridize with a
    specific labeled
  • nucleotide sequence (probe).
  • Probes
  • Range in size from small (16 mers) to very
  • large (500) DNA fragments
  • Labeled at their terminus through kinase
    treatment
  • or internally through nick translation
  • Labels can be in the form of isotopic or
    chromogenic

14
Polymerase Chain Reaction (PCR)
  • Polymerase Chain Reaction (PCR)
  • Invented in 1983 by Kary Mullis Nobel Prize in
    Chemistry 1993
  • Allows the rapid amplification of DNA
  • Core components include
  • Template
  • Purity, source, concentration
  • genomic DNA 100-250 ng
  • plasmid DNA 20 ng
  • Buffer
  • MgCl2 necessary
  • (0.5mM to 3.0mM ? 1.5mM default)
  • dNTPs
  • Final conc 200?M - too high can inhibit rxn
  • Polymerase
  • Error rate and Conditions (next slide)
  • Primer(s)
  • Size (typically 18-30 nt)
  • GC content (40-60)
  • Critical Parameter
  • Annealing Temperature
  • About 5-7C below Tm of primer pairs
  • Annealing Time
  • Rule of thumb is 1kb per minute
  • Primer Design
  • Discussed later

15
LOTS OF POLYMERASES
  • Taq Polymerase
  • Isolated from Thermus aquaticus in 1976
  • Catalyze template-directed synthesis of DNA
    from nucleotide triphosphates
  • Requires a primer having a free 3' hydroxyl is
    required to initiate synthesis
  • Magnesium ion is necessary
  • Has a maximal catalytic activity at 70 to 80 C
    (optimal is 72C)
  • Incorporates approx. 125,000 nucleotides before
    making an error
  • Other themostable polymerases
  • Pfu Pyrococcus furiosus
  • Lowest error rate of known thermophilic
    polymersases
  • Incorporates approx. 767,000 nucleotides before
    making an error
  • Vent (or Ttl) Thermococcus litoralis
  • The most heat stable of all (halflife of 7 h at
    95C)
  • Tgo Thermus aquaticus
  • Highly processive copies fast

16
  • Primer Design
  • Size (typically 18-30 nt)
  • GC content (40-60)
  • Minimize secondary structure ?
  • Concentration (0.1 and 0.5 mM)
  • Avoid runs of 3 or more G or C at the 3' end
  • Avoid a T at the 3' end
  • Avoid mismatches at the 3' end
  • Avoid complementary sequences within a primer
    and between primers
  • Melting Temperature (Tm)
  • Tm by definition is the temperature in which ½
    the molecules in a hybridizing pair are single
    stranded
  • Calculating the Tm
  • 2 4 rule
  • Software Primer Premiere
  • Online IDTDNA.com
  • Trial and error

17
Primer Design Calculating the Tm using the
24 rule
TACCTAGGTTGACCATCTACTAA
TACCTAGGTTGACCATCTACTAA 9 GC
TACCTAGGTTGACCATCTACTAA 14 AT
Tm 2C x (14) 4C x (9) Tm 28C
36C 64C
18
  • Types of PCR
  • Real-time PCR
  • More quantitative than conventional PCR
  • Measurements are taken early in reaction rather
    than at the end point as in
  • conventional PCR
  • RT-PCR
  • Makes cDNA from RNA
  • Nested-PCR
  • Consists on two consecutive PCR reactions
  • The amplified product from the first reaction
    acts as template DNA for the second
  • See Supplement online
  • Hot-start PCR
  • Reaction starts at 98C without a slow warm up
  • Primers do not have the chance to anneal at
    temperatures lower than the Tm
  • Amplified products tend to be cleaner

19
Real-Time PCR
  • Based on detecting and quantifying the
    fluorescence of a reporter
  • Real-time PCR monitors the fluorescence emitted
    during the reaction as an indicator of amplicon
    production at each PCR cycle (in real time) as
    opposed to the endpoint detection
  • Three general methods for the quantitative
    detection
  • DNA-binding agents (SYBR Green)
  • Hydrolysis probes (TaqMan, Beacons, Scorpions)
    utilizes exonuclease activity of polymerase!
  • Hybridization probes (Light Cycler)

More than you would ever want to know
http//www.dorak.info/genetics/realtime.html
20
The fluorescent signal increase in direct
proportion to the amount of PCR product in a
reaction. By recording the amount of
fluorescence emission at each cycle, it is
possible to monitor the PCR reaction during
exponential phase where the first significant
increase in the amount of PCR product correlates
to the initial amount of target template.
21
  • Real-time PCR advantages
  • not influenced by non-specific amplification
  • amplification can be monitored real-time
  • no post-PCR processing of products (no gel
    analysis, low contamination risk, less loss)
  • rapid cycling (30 minutes to 2 hours)
  • range of detection is as low as a 2-fold change
    up to 1010-fold
  • requirement of 1000-fold less RNA than
    conventional assays
  • confirmation of specific amplification by
    melting point analysis
  • not much more expensive than conventional PCR
    (except equipment cost)

22
What are the more common techniques used to study
proteinDNA interactions?
  • Gel shift (EMSA)
  • DNase footprinting
  • Chromatin immunoprecipitation (ChIP)
  • Promoter pull-down

23
Gel Shift or Electrophoretic Mobility Shift Assay
(EMSA)
  • Assay provides a simple and rapid method for
    detecting in vitro interactions between DNA and
    proteins
  • Commonly used to study sequence-specific
    DNA-binding proteins such as transcription
    factors
  • The assay is based on the observation that
    complexes of protein and DNA migrate through a
    non-denaturing polyacrylamide gel more slowly
    than free DNA fragments or double-stranded
    oligonucleotides

24
Binding Reaction Protein/Extract Labeled
Probe Buffer Antibody Competitor DNA
Excess unlabeled oligonucleotide Antibody to
DB Protein
DB Protein Labeled oligonucleotide
25
DNase Footprinting
  • The method of choice for identifying sequence
    specific binding of proteins to DNA
  • Developed in 1978 by Galas and Schmitz

Look for papers on Biochemistry
website Galas_and_Schmitz_Footprinting.pdf Kang_F
ootprinting.pdf
26
Chromatin Immunoprecipitation Assay (ChIP)
Chromatin immunoprecipitation (ChIP) is a
powerful in vivo method to show interaction of
proteins associated with specific regions of the
genome. ChIP allows you to detect recruitment
of a particular transcription factor to a
promoter region, analyze the interaction of any
protein with any DNA sequence in vivo.
Fragments of DNA purified by ChIP can be used
for cloning (i.e. Farnham paper)
More information can be found at
http//www.upstate.com/chip and
Farnham_ChIP_Cloning.pdf (Biochemistry website)
27
Purified DNA ready to be assayed (i.e. PCR)
Protein bound DNA within nuclei (only nuclei
shown)
Crosslink DNAProteins Isolate and lyse nuclei
Purify DNA
Shear DNA sonication most common method
Reverse crosslink by incubating at 67C with
200mM NaCl
Add antibody against protein of interest and IP
proteinDNA complex
Wash extensively with various salt buffers and
release antibody from proteinDNA complexes with
elution buffer (SDSNaHCO3)
28
Promoter Pull-down
Technique to identify proteins that bind to a
specific DNA sequence
29
RNA Analysis
  • RT-PCR
  • PCR based cDNA cloning
  • northern blot
  • RNase Protection
  • Primer extension
  • Nuclear run-off
  • Race and Exon Trapping

30
Reverse Transcriptase-PCR (RT-PCR)
  • Technique used to make cDNA from RNA
  • Template RNA
  • Two consecutive reactions
  • Reaction 1 ? Reverse transcription of RNA into
    cDNA (RNADNA hybrid)
  • Reaction 2 ? Standard PCR reaction to make
    double stranded cDNA
  • Most Common Uses
  • Looking at gene expression (mRNA levels)
  • Assaying viral systems

31
RT-PCR
  • Basic Reaction Mixture
  • RNA
  • dNTPs
  • Primers
  • 1x Buffer
  • Reverse Transcriptase
  • RNase Inhibitor
  • Thermophilic Polymerase

32
PCR based cDNA Cloning
Commonly used to make a cDNA library from mRNA
33
Northern Blots
Similar to southern blots in that it involves the
separation of RNA species on agarose gels and
their transfer to nitrocellulose. Unlike
Southern blots, Northern blots are separated on a
denaturing formaldehyde-agarose gel and gels are
not treated with NaOH prior to transferring to
nitrocellulose.
34
Nuclease Protection Assay (NPA)
Nuclease protection assays (NPAs) include both
ribonuclease protection assays (RPAs) and S1
nuclease assays These two assays are an
extremely sensitive method for the detection,
quantification and mapping of specific RNAs in a
complex mixture of total cellular RNA. There are
several advantages to this technique including
(1) multiple mRNAs can be assayed in a single RNA
preparation (2) the length of each gene fragment
is unique allowing multiple probes to be
synthesized together and hybridized to a single
target sample (3) highly specific and sensitive
assay allowing the detection of sub-picograms
quantities of specific mRNA
  • The basis method involves
  • Hybridize in solution a single-stranded antisense
    probe(s) to an RNA sample
  • After hybridization, any unhybridized probe and
    sample RNA are removed by digestion with
    nucleases
  • The nucleases are inactivated and the remaining
    probetarget hybrids are precipitated.
  • These products are separated on a denaturing
    polyacrylamide gel and are visualized

Detailed Information can be found at
http//www.ambion.com/techlib/basics/npa/
35
RNase Protection Assay
What in the world would you use this for??
Example You knockout a transcription factor in
a mouse. You want to know if the lack of
this transcription factor affects the
transcription of gene X, gene Y, and gene Z. You
can probe for the presence of the mRNA for each
of the genes in question using RNase Protection
Assays
36
Primer Extension
Primer extension is used to map the 5' ends of
DNA or RNA fragments.
Basic Protocol 1. A specific oligonucleotide
primer is labeled, usually at its 5'
end, with 32P 2. The labeled primer is annealed
to a position downstream of that 5' end
of the template 3. The primer is extended with
reverse transcriptase (making a fragment
that ends at the 5' end of the template).
DNA polymerase can also be used with DNA
templates. 4. The newly synthesized labeled
fragment is analyzed by gel
electrophoresis
What in the world would you use this for??
  • Can identify the transcription start site
  • RPA can tell you if a mRNA species is present but
    primer extension can provide sequence size

For more information see http//www.promega.com/t
bs/tb113/tb113.pdf
37
Nuclear Run-off Assays
  • Sensitive method for measuring rates of
    expression (transcription) of a specific gene
  • Based on incorporation of radiolabeled NTPs
    into elogating mRNAs and counting the
  • radioactivity
  • General Protocol
  • Isolate nuclei
  • Incubate with 32P-UTP
  • Treat with DNase
  • Hybridize to denatured-immobilized cDNA
    corresponding to the mRNA
  • Treat with RNase
  • Count radioactivity

Biochemistry Website Baldassare_NRO.pdf Li_Chaiko
f_NRO.pdf
38
Nuclear Runoff Assay
Endotoxin (stimulates Tc)
Imidazole
Assaying the effect of SB203580 (imidazole) on
IL-1 (cytokine) gene transcription in RAW264.7
cells Raw264.7 cells were stimulated with LPS
(endotoxin from E. coli) in the presence or
absence of SB203580 at the indicated
concentrations and analyzed by nuclear run-on
analysis Equal cpm of radiolabeled run-on RNA
were used to probe individual nylon strips
carrying an excess of the indicated denatured
cDNA probes. The Bluescript plasmid (BS) was
included as a background control because the
murine IL-1 and IL-1ß, and TNF-   cDNAs were all
subcloned into this plasmid. The blots were
exposed for 23 wk, and the resultant films were
scanned and digitized on a PhosphorImager. Shown
are representative data from four separate
similar experiments. Conclusion the imidazole
does inhibit transcription of the cytokine IL-1?
Baldassare et al., J. Immunol. 1999 May
1162(9)5367-73
39
Rapid Amplification of cDNA Ends (RACE)
RACE is a procedure for amplification of nucleic
acid sequences from a messenger RNA template
between a defined internal site and unknown
sequences at either the 3' or the 5' -end of the
mRNA 2 Types of RACE 5' RACE and 3' RACE
Why would you use RACE?
Amplify and characterize regions of unknown
sequences -or- amplification of rare messages
for which little sequence information is known
Detailed Information can be found
at http//www.invitrogen.com/content/sfs/manuals/
5prime_race_man.pdf
40
(No Transcript)
41
Exon Trapping
  • Exon Trapping is used to isolate the transcribed
    sequences (exons) of a gene from genomic DNA
  • The exon trapping methods and vector were
    developed Alan Buckler et al.
  • Basic Protocol
  • Random segments of chromosomal DNA are inserted
    into an intron present within a mammalian
    expression vector
  • The cloned DNA is transfected into COS-7 cells
  • Amplified exons are spliced such that the vector
    and genomic exons are paired
  • Cytoplasmic mRNA is harvested and screened by PCR
    amplification for the acquisition of an exon from
    the genomic fragment ? the presence of two BstX I
    restriction sites flanking the MCS helps minimize
    the recovery of vector-vector splicing or cryptic
    splicing

Publication Buckler_Orig_Paper.pdf
(Biochemistry website) More information can be
found at http//www.invitrogen.com/content/sfs/ma
nuals/18449017.pdf and Online Supplement
42
  • Splicing
  • consensus sequences

3? splice site splice acceptor site
5? splice site splice donor site
exon
intron
exon
intron
A
NCAG G
AG GU AGU
MCS
G
43
Microarray Technology
A technique scientist use to allow them to easily
detect and measure the expression of thousands of
genes at one time. Involves a DNA glass slide
that is fixed with tiny amounts of a large number
of single-stranded DNA fragments.
  • Uses
  • Studying differences in gene expression amongst
    a variety of genes in one organism
  • Studying differences in gene expression between
    genetically similar organisms
  • Compare cancerous tissue with noncancerous
    tissue
  • General Protocol
  • Hybridization Make labeled cDNA from mRNA and
    apply to the DNA chip
  • Rinse off excess cDNA and scan for fluorescence
  • Each fluorescent spot will indicate that the
    cDNA strand was complimentary to the strand
  • on the DNA chip
  • Ratio of fluorescence emission indicates
    relative abundance of each mRNA

Interesting articles on the Biochemistry
website EricLander_Microarray.pdf Brown_Botstein_
Microarray.pdf
44
END
Write a Comment
User Comments (0)
About PowerShow.com