Title: www'darwincountry'org
1Unveiling of the Charles Darwin Statue outside
the Museum and Library in 1897. The building was
the original Shrewsbury School building at which
Charles Darwin was a pupil.
www.darwincountry.org
2(No Transcript)
3(No Transcript)
4The Origin of Species and the evolution of the
revolution in taxonomy and systematics
ATGCTTGAAGCTTGTTGCTGCTTGTGTAAGGGAAGCTTG
ATGCTTGAAGCTTGTTGCTGCTTGTGTAAGGGAAGCTTG
Michael Russell Villanova University
5Outline
- Phylogenetic Context of Diversity
- Linnean Hierarchical System (1700s)
- Descent with modification
- Cladistics meets taxonomy
- Phylocode - new the new taxonomy?
www.utexas.edu
6Biodiversity in a Phylogenetic Context
- Two basic patterns of evolutionary change can be
distinguished - Anagenesis
- Cladogenesis
From Campbell Reece BiologyI 7th Edition
7Phyologeny
- A valid clade is monophyletic
- Signifying that it consists of the ancestor
species and all its descendants
From Campbell Reece BiologyI 7th Edition
8Carl Linnaeus
- 1707 1787
- Swedish naturalist
- Religion / Science
- Classification
9Linnean Hierarchical Taxonomic System
Based on mutually exclusive nested sets
Canis lupus
Fig 1.10
From Campbell Reece BiologyI 7th Edition
10Carl Linnaeus
- 1707 1787
- Swedish naturalist
- Religion / Science
- Classification
- Sexual system for plant classification
- Described gt 11,000 species
God created but Linneaus classified.
11Linnean Society, London
12Linnean Society, London
13Linnean Society, London
14Linnean Society, London
15Linnean Society, London
16Linnean Society, London
17Linnean Society, London
18Linnean Society, London
19Description of species
- Started with Systemae Naturae
- Published (peer-reviewed journal) report
- Type specimen, deposited in a museum
20Descent with modification
Erasmus Darwin (Charles Darwin's Grandfather)
21Alfred Russell Wallace
22Descent with modification
Natural Selection
- Intraspecific variation
- Heritable
- Differential survival and/or reproduction
23(No Transcript)
24(No Transcript)
25Down House Borough of Bromley SE of London
. . . . I can remember the very spot in the
road, whilst in my carriage, when to my joy the
solution occurred to me. Autobiography
Google Earth
26Down House
27Down House
28The Sand Walk
29The Sand Walk
30Green House and Laboratory
31Drawing room
32The study
33Notebooks
34Transmutation notebook
35Museum of Natural History, London
36Origin of Species manuscript pages
37Origin of Species manuscript pages
38Origin of Species manuscript pages
39 . . . sketch of his species theory . . .it
will be a considerable step in science.
Personal letter to Emma
40- Linnean System in effect before idea of descent
with modification
. . . . the natural system is founded on
descent with modification . . . characters
showing true affinity . . . are those which have
been inherited from a common ancestor, and, in
so far, all true classification is genealogical
that community of descent is the hidden bond
which naturalists have been unconsciously
seeking, and not some unknown plan of creation .
. . On the Origin of Species - 1859
41Outline
- Phylogenetic Context of Diversity
- Linnean Hierarchical System (1700s)
- Descent with modification
- Cladistics meets taxonomy
- Phylocode - new the new taxonomy?
www.utexas.edu
42- Linnean System in effect before idea of descent
with modification
On the Origin of Species - 1859
43Linnean Hierarchical Taxonomic System
Based on mutually exclusive nested sets
Canis lupus
Fig 1.10
44- Linnean System in effect before idea of descent
with modification
On the Origin of Species - 1859
Taxonomy given phylogenetic interpretation
Cladistics and Phenetics Wars of the 20th Century
45Phyologeny
- A valid clade is monophyletic
- Signifying that it consists of the ancestor
species and all its descendants
From Campbell Reece BiologyI 7th Edition
46New PhyloCode
Traditional Linnean
47New PhyloCode
Traditional Linnean
48Historical Overview
1700s Linnean Hierarchical System
1800s Process descent with modification
1900s Taxonomy meets Systematics
2000s ? Possibly working out genealogy
49(No Transcript)