DNA structure

1

• DNA structure
• Method of Maxam / Gilbert
• Method of Sanger

2

• Sequencing of polymers
• Polysaccharides Cleave at specific connections
  and identify (all) the pieces (by MS, ...).
• Polypeptides Cleave off terminal monomers
  independent off type and identify them (by HPLC).
• Polynucleotides Cleave after a specific type of
  base, but randomly in sequence, and identify all
  pieces at once (by PAGE).

3

• Sequencing by the method of Maxam Gilbert
• Synthesize new copies with template, primer
  (oligo), dNTPs, and polymerase.
• Cleave the strands chemically
• Treatment in several steps with DMS
  (dimethylsulfoxid) or hydrazine, piperidine and
  various pH values removes a base and cleaves the
  two adjacent phosphoester bonds. Thus, the DNA
  ends at G, GA, CT, or C.

4

• Method from Sanger
• Synthesize new copies with template, primer
  (oligo), dNTPs and ddNTPs, and polymerase.
• Dideoxy nucleotides (ddNTP) stop DNA synthesis at
  specific nucleotides.  For example, if the ddCTP
  to the right is incorportated into a growing
  strand of DNA, the lack of a free 3 OH group
  would prevent the next nucleotide from being
  added, and the chain would terminate.
• By labeling each ddNTP with a different
  fluorescent label the strands with ddA at the end
  fluoresce different than those with ddT at the
  end (and ddG and ddC).

5

• Method from Sanger

6

• Method from Sanger

7
A
C
C
C
G
T
T
G
ddCTP
8

• Method from Saenger
•   Manual sequencing uses radiolabeled dATP (35-S
  or 33-P) to label the DNA.  The sample is then
  split into four tubes  each with an individual
  ddNTP present.  The samples are then subjected to
  acrylamide gel electrophoresis followed by
  autoradiography.

9

• Method from Sanger
• Labelling the ddNTPs allows to put all four
  reactions in one tube and on one lane. The
  fluorescence is strong enough for online reading
  of the bases.

10

• Method from Sanger

11

• Strategies
• Divide and conquerSubclone into ever smaller
  pieces, of which the arrangement is known by
  restriction analysis, then sequence
• Primer walkingStart at one end of a larger piece
  and use the sequence of the end of the first
  sequencing reaction for the primer design of the
  second sequencing reaction, ...
• Shotgun sequencing (Schrotschuss)Subclone many
  small pieces randomly and assemble the sequences
  in the computer

12

• Strategies
• People who don't trust the software generally put
  a lot of time into the preparation of DNA
  fragments before sequencing dividing large
  pieces of DNA into small ordered overlapping
  fragments. This strategy requires much more
  initial cloning work in the laboratory, but
  usually minimizes the number of actual sequencing
  reads required to complete a project, and makes
  minimal demands on software to organize the reads
  since it is known how they should fit together to
  form the final contig.
• A second strategy known as "primer walking"
  requires very fast and accurate analysis of
  sequence reads since each sequencing reaction
  uses information from the previous read. Again,
  assembly problems are minimized since both the
  order and the amount of overlap of the reads are
  known.
• A third strategy, know as "shotgun sequencing"
  takes maximum advantage of the speed and low cost
  of automated sequencing, but relies totally on
  software to assembly a jumble of essentially
  random sequence reads into a coherent and
  accurate contig. This approach relies on many
  more individual sequencing reactions, but much
  less meticulous cloning and record keeping for a
  large project. The Institute for Genomic Research
  (TIGR) has demonstrated the power and utility of
  this shotgun approach by determining the complete
  genomic sequences of Haemophilus influenzae ,
  Methanococcus jannaschii , and Mycoplasma
  genitalium.

13

• Wich strategy is really used?
• Use more what you can do best, use the other
  strategies only as much as necessary.
• Many sequencing projects use approaches that
  involve a mixture of these three basic
  strategies. Large sections of genomic DNA are
  first carefully sub-cloned into overlapping
  megabase-sized fragments (YACs), which are then
  carefully sub-cloned into overlapping 20-40 KB
  fragments (cosmids or lambda clones), and then
  these fragments are shotgun sequenced. Gaps in
  the assembled sequences are then filled by primer
  walking.

14

• T7 polymerase (sequenase)
• High processivity, high accuracy, more template
  needed
• Taq DNA polymerase
• Less template needed, lower accuracy, higher
  temperatures (good for GC rich sequences, dsDNA
  as template)

15

• Cloning vectors for DNA sequencing
• M13 bacteriophageProduces single stranded DNA,
  but more effort to grow (0.1-0.25 µg )
• Double stranded plasmid vectors Most commonly
  used, needs a bit more DNA (0.25-0.5 µg )
• Cosmids, YACs, PACs and BACs Large DNA inserts,
  needs most DNA (0.5 -1 µg).

16

• Primer design and optimization
• Primers should be 20-30 bp long and have melting
  temperatures (Tm) of 55-65C.
• Where possible, primers should be made with a GC
  content of 50-55. For primers with a much lower
  GC content, the primer sequence may need to be
  extended to more than 20 bases to keep the Tm
  above the recommended lower limit of 55C.
• Primers with long runs of a single base should be
  avoided, especially if that run occurs at the 3
  end. A long run of a single base encourages
  secondary hybridisation on other targets that
  happen to contain the complimentary motif.

17

• Primer design and optimization
• Wherever possible there should be at least one G
  or C at the 3 end to stabilize this end of the
  primer.
• Primers that show secondary structure or that can
  hybridize to form dimers or oligomers should be
  avoided. These internal relationships can be most
  easily predicted if a primer design program is
  used.
• Primers should be resuspended in sterile,
  distilled water, not in TE!

18

• PCR (polymerase chain reaction)

19

• PCR (polymerase chain reaction)
• Two specific primers are needed
• Primer length should be 18-24, longer primers
  anneal less efficiently
• Annealing temperature 55-72C, similar for both
  primersGuide Tm 2(AT) 4(GC)
• Avoid primer dimers and loop structures
• Use G/C at the 3 end
• Range for dNTPs 40 - 200 mM
• Correct MgCl2 concentration (1-4 mM) (mix after
  thawing)

20

• PCR (polymerase chain reaction)
• Many compounds inhibit the polymerase (EDTA,
  ethanol, SDS, ...)
• Primer concentration 0.1 - 1.0 mM
• Amount of template 104 molecules is enough
• Choice of polymerase (Taq, proofreading
  polymerases, Pfu) influences fidelity and yield

21

• Fluorescent proteins from nonbioluminescent
  Anthozoa species
• Matz et al., Nature Biotechnology, 1999, 17,
  969-973
• Fluorescent proteins are not necessarily linked
  to bioluminescence.
• They also occur, for instance, in corals (many of
  them Anthozoa) providing protection from sunlight
  (UV) or converting blue light to green light for
  photosynthesis of their endosymbionts.

22

• Cloning
• RNA was prepared from the colored body parts of
  the Anthozoa
• For cDNA construction, 5-CGCAGTCGACCG(T)13-3
  primer were used.
• Related sequences were amplified with 3-RACE
  (rapid amplification of 3-cDNA ends). Primers
  weregt derived from GFP (a-helix, b-turns)gt
  derived from conserved regions
• 5-ends were identified by step out RACE

23

• Cloning
• cDNA construction
• Primer 5-CGCAGTCGACCG(T)13-3
• mRNA contains polyA tails.
• 5......UGA AAAAAAAAAAAAA
• ..........................TTTTTTTTTTTTGCCA...
  5
• The GTCGAC sequence can be used for cloning
  (restriction site SalI).

24

• Cloning
• 3-RACE (rapid amplification of 3-cDNA ends
• 5-GTCGAC...TTTTTTTT.....reverse
  gene..................CAT...
• ................................................
  ...........primer 1-5
• ................................................
  .primer 2-5
• By using two (nested) primers, unspecific
  background can be eliminated.

25

• Cloning
• 5-RACE (rapid amplification of 5-cDNA ends)
• 5-GTCGAC...TTTTTTTT.....reverse gene..CAT...
• One copy with known primer 5-primer............
  ....
• Apend As 5-primer................AAAAA
• PCR with polyT primer .......................
  .......TTTTT-5

26

• Cracks in the b-can Fluorescent proteins from
  Anemoinia sulcata
• Wiedemann et al., PNAS, 2000, 97, 14091-14096
• The sea anemone has three distinguishable
  fluorescent proteins and one colored protein.
• Cloning revealed two sequences for GFP relatives.

27

• Cracks in the b-can Fluorescent proteins from
  Anemoinia sulcata
• Wiedemann et al., PNAS, 2000, 97, 14091-14096
• The sea anemone has three distinguishable
  fluorescent proteins and one colored protein.
• Cloning revealed two sequences for GFP relatives.

28

• Cloning
• RNA was prepared from tentacles of Anemonia
  sulcata
• The cDNA therefrom was cloned into an expression
  vector.
• Transformed E. coli were plated and viewed under
  UV.
• 1 in 700 colonies were green fluorescent, 1 in
  50000 were red. The corresponding clones were
  sequenced.
• One gene was significantly shorter than all known
  GFPs
• Normal 230-270 aa Gene 1 228 aa Gene 2 148 aa

29

• Sequence alignment of the resulting proteins

30

• Why is one GFP relative different to all others?
• The structure shows an a-helix with chromophore
  tightly enclosed by 11 b-strands (b-can).

With 5 b-strands missing, how can the protein
still function? Access of bulk solvent to the
chromophore should quench the fluorescence. Gel
filtration results in a molecular weight of 66
kDa for the native proteingt the protein is a
dimer or trimer.
31

• Why is one GFP relative different to all others?
• Could formation of the oligomer rescue the
  static, solvent inaccessible environment of the
  chromophore?

32

• Why is one GFP relative different to all others?
• It isnt, the sequence was wrong!

Old sequence gctgatggcccccgtgatgcagaacaaagcagaaaga
tgggagccagccaccgagatactttatga AlaAspGlyProArgAspAl
aGluGlnSerArgLysMetGlyAlaSerHisArgAspThrLeu Ne
w sequence gctgatggcccc gtgatgcagaacaaagcagaaagatg
ggagccagccaccgagatactttatgaagtt AlaAspGlyPro
ValMetGlnAsnLysAlaGluArgTrpGluProAlaThrGluIleLeuTy
rGluVal
How could this happen? The sequence contains a
polyC stretch in the misread place, which is
notoriously difficult to read. The correct gene
contains 232 aa just normal.