Title: Dan Graur
1Molecular Phylogenetics
2?
3 Charles Darwin to Thomas Huxley (1857)
The time will come I believe, though I shall not
live to see it, when we shall have fairly true
genealogical phylogenetic trees of each great
kingdom of nature.
4The Tree of Life Homepage (University of
Arizona) http//phylogeny.arizona.edu/tree/phyloge
ny.html
5Objectives of phylogenetics
- Reconstruct the correct genealogical ties among
biological entities - Estimate the time of divergence between
biological entities - Chronicle the sequence of events along
evolutionary lineages
6(No Transcript)
7preciptin test
George Henry Falkiner Nuttall 1862-1937 Blood
Immunity and Blood Relationship (1904)
8preciptin test
The closest relatives of humans are the apes,
followed in order of relatedness, by the Old
World monkeys, the New World monkeys, the
prosimians, and the ungulates.
9(No Transcript)
10Nomenclature, Systematics,Phylogenetics,
Taxonomy, Classification
- Nomenclature the naming of organisms
- Classification the assignment of taxa to groups
of organisms - Taxonomy Nomenclature Classification
- Phylogenetics Evolutionary patterns
relationships among organisms - Systematics Taxonomy Phylogenetics
11Before we can answer phylogenetic questions, we
have to deal with the concept of species
121. What is a species?2. How do species
originate?
13Species Concepts
- Species concepts are linked to views on how
species originate. - Early views were associated with a creationist
view and were non-evolutionary. - Today, some species concepts take evolution into
account and attempt to address problems that are
associated with biological entities that are
evolving rather than immutable.
14Species Concepts
- There are many difficulties associated with the
definition of species. - Concepts that work well for some groups of
organisms do not necessarily work for other
organisms. Also, concepts that work well for
extant species do not always apply to the case of
fossil species.
151. The Typological Species Concept
- Species are discrete, stable, and unchanging.
- The concept dates back to Aristotle (384 BCE 322
BCE). - Linnaeus (1707 1778), who held a creationist
view, defined a type (typus) specimen for each
species and provided it with a Latin binomial. - Individuals were assigned to a species if they
had the characteristic morphology of the type.
161. The Typological Species Concept
Most Typological Species Are Defined on the basis
on morphology morphospecies
Other Typological Species May be Defined on the
basis on serotype (serospecies), genotype
(genospecies)
17Clusiella albiflora
18Cabramatta New South Wales, 11101959 C. E.
Chadwick on trunk of dead Acacia fulcata.
Jaczyk, F. (1966). Ein neue Laemosaccus aus
New-Südwales (Australien). Annalen des
Naturhistorischen Museums in Wien 63 213-214.
Laemosaccus chadwicki Jaczyk
191. The Typological Species Concept
- The basic Linnaean system remains in place today
despite its non-evolutionary stance on the origin
of species. - The idea of morphospecies has practical value,
especially for paleontologists that must rely
heavily on morphological features.
202. The Phenetic or Numerical Taxonomy Species
Concept
- A species is defined as a set of organisms that
resemble one another and is distinct from other
sets (no ideal type). - A modern outgrowth of the typological concept.
Evolutionary change is acknowledged, but
phenotypic similarity is used for defining
species. - Numerical measurements of as many characters as
possible are used to define clusters of organisms.
214 legs
black
223. The Biological Species Concept
- The biological species concept was proposed by
Theodosius Dobzhansky in the 1930s. It has been
elaborated on and reworked by Verne Grant, Julian
Huxley and Ernst Mayr. - Mayrs definition Species are groups of
interbreeding natural populations that are
reproductively isolated from other such groups. -
233. The good things about the Biological Species
Concept
- Species are cohesive gene pools that are held
together by gene flow. Organisms in a species are
defined by the exchange of genes, or at least by
the potential to exchange genes. Gene flow is the
glue that holds a species together. - Biological species are reproductively isolated
from each other. Reproductive isolation severes
the ties that bind populations together and
allows populations to diverge from each other.
244. The bad things about the Biological Species
Concept
- The concept applies to sexually reproducing
species and has no application to asexual
organisms. - The concept cannot be applied to fossils or
museum specimens. - Overlapping ranges and partial interbreeding
render the biological species concept difficult
to apply in practice.
254. The Evolutionary/Phylogenetic Species
Concept (the theory)
- Promoted mainly by George Gaylord Simpson
- An evolutionary species is a lineage (an
ancestor descendant sequence of populations),
evolving separately from others and with its own
unitary evolutionary role and historical
tendencies.
264. The Evolutionary/Phylogenetic Species
Concept (the practice)
- A species is the smallest diagnosable cluster of
individual organisms within which there is a
parental pattern of ancestry and descent. - Species are not recognized strictly in terms of
whether they can be diagnosed, i.e., whether or
not they have unique morphological, biochemical,
or physiological phenotypes.
274. The good things about the Phylogenetic
Species Concept
- This species definition derives from an
evolutionary perspective of ancestry and descent.
- It results in a natural hierarchical
classification.
28Carolus Linnaeus (1707-1778)
29The Linnaean hierarchy
304. The bad things about the Phylogenetic
Species Concept
- We may end up with too many taxa
31The Linnaean hierarchy of Panthera leo (1/2)
Euteleostomi (bony) Sarcopterygii
(lobe-finned fish tetrapods) Tetrapoda (4
legs) Amniota (amnion)
Mammalia (mammals) Theria
(internal egg) Eutheria
(placenta) Carnivora
(carnivores) Fissipedia
(terrestrial carnivores)
Felidae (cats)
Pantherinae (big cats)
Panthera (lion, jaguar, leopard, tiger)
Panthera leo (lion)
32The Linnaean hierarchy of Panthera leo (2/2)
Eukarya (nucleated cells) Opisthokonta
(fungi metazoans) Metazoa
(multicellulars) Eumetazoa
(animals) Bilateria (bilateral
symmetry) Coelomata
(mesodermal cavity)
Deuterostomia (secondary mouth)
Chordata (chordates)
Craniata (head)
Vertebrata
(vertebrae) Gnathostomata
(jaws)
334. The bad things about the Phylogenetic
Species Concept
- The definition of species is arbitrary.
34Is there a perfect "species concept?
355. The Intuitive Species Concept
Hard-core pornography I shall not today
attempt to define the kinds of material I
understand to be embraced within that shorthand
description, and perhaps I could never succeed in
intelligibly doing so. But I know it when I see
it. Justice Potter Stewart 1964 Jacobellis vs.
Ohio
365. The Intuitive Species Concept
Nor shall I here discuss the various definitions
which have been given of the term species. No one
definition has as yet satisfied all naturalists
yet every naturalist knows vaguely what he means
when he speaks of a species. I look at the
term species as one arbitrarily given, for the
sake of convenience, to a group of organisms
resembling each other. Charles Darwin. 1859.
The Origin of Species.
375. The Intuitive Species Concept
I look at the term species as one arbitrarily
given, for the sake of convenience, to a group of
organisms resembling each other. Charles
Darwin. 1859. The Origin of Species by Means of
Natural Selection.
38OK, so we do not have an answer to What is a
species?What is The Origin of Species?
39(No Transcript)
40(No Transcript)
41(No Transcript)
42Wood frog Rana sylvatica
Northern leopard frog Rana pipiens
43What kind of data?
Molecular (DNA, RNA, proteins)
atcgatcgtgatcgatcgtagcatcgatgcatcgtacg
MWRCPYCGKRQWCMWG
Morphological (soft tissue, hard tissue, extant,
extinct)
44Advantages of Molecular Data 1. Molecular
entities are strictly heritable.
45Advantages of Molecular Data 2. The description
of molecular characters is unambiguous.
Gertrude Stein A rose is a rose is a rose is a
rose.
46Advantages of Molecular Data 2. The description
of molecular characters is unambiguous.
The third amino acid in the preproinsulin of the
rabbit (Oryctolagus cuniculus) is always serine,
and the homologous position in the preproinsulin
of the golden hamster (Mesocricetus auratus) is
always leucine. Morphological descriptions
frequently contain such ambiguous modifiers as
"thin," "reduced," "slightly elongated,"
"partially enclosed," and "somewhat flattened."
47Advantages of Molecular Data 3. There is some
regularity to the evolution of molecular
traits.
48Advantages of Molecular Data 4. Molecular data
are amenable to quantitative treatment.
49Advantages of Molecular Data 5. Homology
assessment is easier than with morphological
traits.
50Advantages of Molecular Data 6. Molecular data
are robust to evolutionary distance.
51Advantages of Molecular Data 7. Molecular data
are abundant.
52Microbial morphologies are mostly very simple,
i.e., they provide only very few characters for
comparative studies.
53Small subunit ribosomal RNA
18S or 16S rRNA
54(No Transcript)
55(No Transcript)
56Proconsul
Black Parts found in situ by Tom Withworth in
1951. Blue Parts found in museum drawers by Alan
Walker Martin Pickford during the restoration
in 1985.
57(No Transcript)