Title: Decipering the Genetic Code
1Decipering the Genetic Code
?
How can four bases code for 20 amino acids?
2Decipering the Genetic Code
What was known?
DNA structure and that it was comprised of
nucleotides containing only four different bases.
Proteins are polymers of amino acids, and there
are 20 different amino acids.
What wasnt known?
Whether one or both strands contained code In
which direction to read the code (5 to 3 or
visversa) That there was an intermediate step,
nor that RNA was involved with transfering the
code
3How do Cells Use the 4 Letter Code?
1 gccatgacgg gctggagctg ccttgtgaca
ggagcaggag ggtttctggg acagaggatc
61 atccgcctct tggtgaagga gaaggagctg
aaggagatca gggtcttgga caaggccttc
121 ggaccagaat tgagagagga attttctaaa
ctccagaaca agaccaagct gacagtgctg
181 gaaggagaca ttctggatga gccattcctg
aagagagcct gccaggacgt ctcggtcatc
241 atccacaccg cctgtatcat tgatgtcttc
ggtgtcactc acagagagtc tatcatgaat
301 gtcaatgtga aaggtaccca gctcctgtta
gaggcctgtg tccaagctag tgtgccagtc
361 ttcatctaca ccagtagcat agaggtagcc
gggcccaact cctacaagga aatcatccag
421 aatggccatg aagaagagcc tctggaaaac
acatggcccg ctccataccc acacagcaaa
481 aagcttgctg agaaggctgt actggcggct
aacgggtgga atctgaaaaa cggcggcacc
541 ctgtacactt gtgccttacg acccatgtat
atctatgggg aaggaagccg attcctttct
601 gctagtataa acgaggccct gaacaacaat
gggatcctgt caagtgttgg aaagttctcc
661 actgttaacc cagtctatgt tggcaatgtg
gcctgggccc acattctggc cttgagggcc
721 ctgcaggacc ccaagaaggc cccaagcatc
cgaggacagt tctactatat ctcagatgac
781 acgcctcacc aaagctatga taaccttaat
tacaccctga gcaaagagtt cggcctccgc
841 cttgattcca gatggagctt tcctttatcc
ctgatgtatt ggattggctt cctgctggaa
901 atagtgagct tcctactcag gccaatttac
acctatcgac cgcccttcaa ccgccacata
961 gtcacattgt caaatagcgt attcaccttc
tcttataaga aggctcagcg agatctggcg
1021 tataagccac tctacagctg ggaggaagcc
aagcagaaaa cggtggagtg ggttggttcc
How do you begin to figure this out?
4The Diamond Code
Physicist George Gamow proposed the first model
based on the Watson-Crick model of DNA. Although
not fully appreciated at the time, it turns out
to predict a triplet code. Crick later showed
that the diamond code couldnt explain all AA
sequences in known proteins.
5Triplet Nature of the Genetic Code
- Based on the knowledge of Gamows work, Crick and
Sidney Brenner postulated a triplet code
reasoning that - one letter code - 4 words
- two letter code -16 words
- three letter code - 64 words
- four letter code - 256 words
They remained uncomfortable about a 3 letter code
producing too many possible codes in excess of
the 20 amino acid. This led them to the
frameshift studies.
6Frameshift Mutations Demonstrating a Triplet Code
7A Role for RNA Discovered
Synthesized a poly(U) RNA chain and used a cell
free, in vitro system to determine whether
poly(U) could give rise to a polypeptide. To
their surprise, a poly-phenylalanine chain was
formed.
Bingo!
What next?
Heinrich Matthaei Marshal Nirenberg
8CPM found in polypeptide
UUUUUUUUU AAAAAAAAA CCCCCCCCC GGGGGGGGG
14C-arg 20 30 20 20 14C-ala 30 20 20 30 1
4C-asn 20 20 40 20 14C-asp 20 20 20 30 14C
-cys 30 30 30 40 14C-gln 20 20 30 20 14C-g
lu 30 40 20 20 14C-gly 40 20 40
10,000 14C-his 20 10 30 30 14C-ile 10 40 50
10 14C-leu 20 20 20 20 14C-lys 30
12,000 30 10 14C-met 10 10 10 10 14C-phe
10,500 20 20 30 14C-pro 20 20
11,000 10 14C-ser 30 20 40 50 14C-thr
20 30 30 20 14C-trp 30 20 20 30 14C-tyr 2
0 30 20 30 14C-val 30 20 30 20 14C-tRNA 20
40 50 10
CPM added of 14C-AA- tRNA
9What Else Do We Need to Know?
- While the Nirenberg experiments showed that RNA
did determine the amino acids in the protein,
they did not show - how many bases were used for each codon,
- whether the codes were overlapping (is the
second codon read from the second base
overlapping or from the first base after the
last base of the first codon no overlap), - whether there could be bases in-between the
codons that did not code for anything
(AUCGGGCAACGGGACAGGGGG, for instance, where the
G's in between AUC, AAC and ACA aren't translated
into amino acids - just like we use spaces to
separate words in a sentence).
10Next Step?
- Khorana developed a means to produce
poly-dinucleotide and, later, poly-trinucleotide
and poly-tetranucleotide sequences of DNA that
could then be transcribed into RNA. - This allowed him to ask such questions as
would you obtain the same polypeptide from a
poly-dinucleotide such as ACACACAC as from
CACACACA?
Example
11The Code is Degenerate
What is the wobble hypothesis?
12Flow of Biological Information
1. Propagation of genetic information generation
to generation
- Control of
- phenotype
- Gene Expression
13RNA Polymerase is Responsible for RNA Synthesis
- One RNA polymerase in E.coli
- Three forms in eukaryotes that allow for
specialization - RNA Pol II is responsible for most mRNA
produced
14Ribosomes
rRNA protein
Prokaryotes 70s (50s-large 30s-small) Eukaryo
tes 80s (60s-large 40s-small)
15tRNA
Classic Diagram
More Realistic Diagram
16Translation Requires mRNA, tRNA, and Ribosome
Come Together