Title: Topics in Informatics
1Topics in Informatics
2About the Instructor
- Instructor Dr. Hong Zhou
- Office McDonough 317
- Office Hours MWF 1000 1100am
- Email hzhou_at_sjc.edu, Phone 231-5826
- Syllabus
- You can all me either
- Hong
- Dr. Hong
- Dr. Zhou
3What is Informatics?
- Search for What is informatics at
http//www.google.com, we got different
definitions. - Basically, the study and application of the
knowledge and skills of data/information flow and
manipulation (including storage, retrieval,
analysis, and construction/deriving, etc).
4Informatics
- Data obtaining
- Data flow and control
- Data representation (records) and storage
- Data retrieval/mining
- Data analysis
- Data derivation (generating new data from
existing data via analysis)
5What Will You Learn
- Obtaining reliable data.
- Data Management (Data Storage and Representation,
Retrieval) ? database. - Introduction to Bioinformatics.
- Introduction to Health Informatics.
6Part I Obtaining Reliable Data
- Complex and precise communication is something
distinguishing us from non-human. - The world development is somehow the development
of our understanding, i.e. information of the
universe including our social systems. - Information and its uses are the center of such
development.
7Information vs Data
- What is in your mind when we talk about
INFORMATION? - Is information touchable, visible?
- To my understanding, data is the description of
information, and information is the
interpretation of data. - So, lets deal with the description ? data, in
this class.
8What is Data?
- When we talk about data, the first image in our
mind might be numbers such as 5, 87, 98.34, etc. - However, are the numbers 5, 87, 98.34
meaningful/informative?
9Data with Context
- Pure numbers are meaningless for us.
- Numbers with context are meaningful, however.
- For example, 5 pounds of sugar.
- So, in this class, we are talking about
meaningful data and ignore all meaningless data.
(Are we meaningful persons?)
10Quick Questions
- Are following data meaningful?
- 20
- 20 years
- A 20 years old girl
- A 20 years old girl named Amie
- A 20 years old girl named Amie who is a SJC
student.
11Data Target
- Data is used to describe a subject.
- For example, age, height, weight, gender,
profession, are description of a person. - Medical record is a description of a patient
12Quick Question
What are the targets of the following two rows of
data?
13What is RELIABLE?
- When we talk about reliable data, what does that
mean? - Lets discuss this issue at two levels
- Individual level
- Group/population level (statistics)
14Individual Level
- Reliable data means that the data is closely
related to the individual (or event) and
precisely describes the individual (or event). - A computer of 3.2 ghz CPU, 512 mb RAM, 512 kb
cache, etc.
15Group/Population Level
- Reliable is more meaningful at the group level.
- Can a specific medical diagnose of a patient be
representative of all patients with the same
symptom? - Probably not.
16Statistical Thinking
- One powerful approach to analyze data is
statistics. - We measure the reliability (significance) of data
in the sense of statistics. - Statistical thinking is to use data to build our
understanding, gain insights, and draw
conclusions or make inferences. - Not drawing conclusion from an incident.
17Principles in Statistical Thinking
- Count on data instead of an incident
- Where the data is from matters.
- Lurking variables
- Variation is everywhere
- Conclusions are not absolutely certain
18Count on large amount of data instead of a few
incidents
- Famous fortune teller
- The thumb of a monk
19Where data is from
- Group data can be collected from surveys or
observations, or obtained from experiments. - When collecting data, where the data come from is
important. For example, once there is a question
If you had it to do over again, would you have
children? 70 from the written responses are
NO. Is this piece information reliable?
20Lurking Variables
- Is music practice improving test scores?
- What is behind?
21The Importance of RANDOM
- The key factor in data collection is the RANDOM
concept, i.e. the data has to be randomly
collected with no bias. - Suppose that you are doing a survey of 2004
election prediction from 10000 people in USA, how
are you going to pick the 10000 persons? Only in
schools? Only in New York? Only women? Avoid as
much as bias as you can.
22Experiments
- Some reliable data can only be produced by
experiments, especially in science. - For example, in biology, to pin down the function
of a gene, you have to knock out the gene or
depress it and check the phenotype changes. After
that, you have to recover the gene and verify if
the phenotype also recovers. Such experiments
are very convincing, but expensive.
23Another Experiment
- It once was believed that women who take hormones
after menopause reduce the risk of heart attack.
The belief was resulted from the studies that
simply compared women who were taking hormones
with others who were not. Are such study results
reliable? - Such experiments lack proper Controls, which are
the essential in all experiments. - How are you going to design an experiment for
this study?
24Reliable Data contd
- It is not a simple task to obtain reliable data,
it requires extensive consideration and design. - Some experiment results may look convincing at
some time, but may lose their reliability over
time or when the environment changes. For
example, the third stop light of cars.
25Discussion
- Is absence of evidence the evidence of absence?
26Project 1
- Write a paragraph to discuss the claim Absence
of evidence is evidence of absence. Please make
your own judgment as the grading is based on your
argument. - Design a simple survey to collect opinions about
terminating death penalty. Be aware of the
importance of RANDOM. Write a short paragraph
to argument that the data collected by your
survey is reliable. - Points 100.
- Due Date Feb 1st, 2005.
- Submit your work in the digital drop box in
Blackboard.
27Part II Data Storage
- Can all information be recorded as data? Lets
start the discussion. - Feeling
- Knowledge
- Intelligence
28Personal Ideas
- My understanding Yes, just some of them are too
complicated or too difficult to manifest
precisely. - And that is whey we have IQ test, MQ
(motivational quotient), EQ, etc.
29Where to store
- Data is stored somewhere.
- Minds
- Books (paper documents)
- Computers
- Etc
- Lets compare the three storage methods, which
one you think more lasting or appropriate?
30Passing Words
- In ancient time, knowledge is passed in words
generation by generation. - Here is a story about passing by words
- General called the captain telling tonight at
700pm, the Halley comet will pass your camp in
the sky. Organize your soldiers to watch. - Captain informed his lieutenant Tonight at
700pm, the Halley comet will pass our camp in
the sky and the general is coming to watch with
our soldiers. - The lieutenant informed the sergeant Tonight at
700pm, the general will accompany Halley comet
passing over our camp, organize the soldiers - The sergeant to soldiers Tonight at 700pm,
general Halley will pass over our camp in sky and
we are going to watch that.
31Data Storage
- Paper storage
- Size and cost
- Transportation
- Computer
- Signature ? legal effect
- Hacking
- What if computers are down?
- However, if data is not organized, it is
difficult to make use of. So, data storage
strategy is important. - In this class, we talk about data storage by
using computer technology.
32Ways to store
- Data storage is a big, and probably the largest
issue related to computer data manipulation. - Different database structures, different database
managements, online storage, etc.
33Chapter 1. File structure
- Hierarchical structure
- Easy to deal with the hierarchical relationships.
- For example, the administration is a hierarchical
structure. - Let me use the DOD/NIMA VPF structure as an
example
34VPF Structure
- DOD (Department of Defense) and NIMA (National
Image and Mapping Agency) sponsored the VPF
development (Vector Product Format) ? Nickname
very poor format - It is used to store the earth ground information
and provide a digital map.
35VPF structure
Database
Library
Coverage
Coverage
Coverage
File1
File1
File1
File1
File1
36Navigation in Hierarchical Structure
What is the purpose of Index?
37Project 2
- Create a hierarchical file structure to store
some your works in SJC. - This is the way I prefer organize your works
based on the classes you take. - If you have other ways, that is ok as long as
they are organized well. - Show me in class what you have done.
- Points 100
38Chapter 2 XML
- Extensible Markup Language
- Purpose
- Data transportation
- Data representation
- Data storage
- Why we should talk about it here? Because the
data inside a XML file is hierarchical
39What XML Promises?
- Data portability
- Programming language Java promises the
portability of programs. - However, programs are working on data. Before
XML, data is not portable, communication among
systems, agencies are extremely difficult. - XML allows systems to communicate using a
standard means of data representation.
40HTML?
- HTML is the portable language for browsers.
- It is a standard.
- However, it governs how information is displayed
in a browser with defined formats and defined
tags.
41The Difficulties XML faces
- XML has some defined formats
- But doesnt have defined tags.
- User defined tags
- Unlimited types of data.
42Solution (Partially)
- Make the information self-explained.
- You have to invent your own tags!
43A Simple Example
-
- Fonship
- Michele
- female
-
- 9/1980
- 5/1985
- Badley school
-
44Tips about XML format
- A tag is case sensitive
- A starting tag must have a closing tag to match
- All XML elements must be properly nested.
- All XML documents must have a root element.
- Attribute values must always be quoted.
45Comments in XML
- Comments in XML
- The syntax for writing comments in XML is similar
to that of HTML. -
- A sample XML file.
46XML Element Naming
- Names can contain letters, numbers, and other
characters - Names must not start with a number or punctuation
character - Names must not start with the letters xml (or XML
or Xml ..) - Names cannot contain spaces.
47Is it valid or not?
nameRose Washingtonst name
48Element Content
- An XML element is everything from (including) the
element's start tag to (including) the element's
end tag. - An element can have element content, mixed
content, simple content, or empty content. An
element can also have attributes.
49Is this valid?
appleit
50Child Elements vs. Attributes
Anna Smith
female Annastname Smith
51Disadvantages of Attributes
- attributes cannot contain multiple values (child
elements can) - attributes are not easily expandable (for future
changes) - attributes cannot describe structures (child
elements can) - attributes are more difficult to manipulate by
program code - attribute values are not easy to test against a
Document Type Definition (DTD) - which is used to
define the legal elements of an XML document
52Using Child Elements?
- So, it is a good idea to use Child Elements other
than Attributes. - Check this out. Tell which way you prefer.
- Can this file work? What is wrong?
53A case for Attribute
- What is metadata? Data about data. For example,
your SJC student ID is a metadata about you since
it does not describe you.
OReilly sssomewhere
54Is this valid?
Eng100 id5Math100 200-300pmfice Hour McDonough Hall 211
What are the errors?
55More about XML
- Now we have so called XML database whose basic
element is XML document. It is not very
successful yet. - Remember that XML does not really do anything
except describing data. - We have to interpret whatever it is describing.
In the sense of computer software, the user has
to develop software to interpret. - What are DTD and XML schema?
- What are the disadvantages of XML? Please
discuss about it.
56Analyze the XML file
- Example XML file
- Lets discuss the weakness of this file.
- What do you suggest?
- How do you think about my solution?
57In class exercise
- Given the data shown in Access database, can we
store the same data in XML format? Please try it
in class. Thanks.
58Useful Sites about XML
- http//www.w3schools.com/xml/
- http//www.xml.org
59XML in Uses?
- BBC topic news are also available online via XML.
Example. - XML at work.
- XML in commerce?
- What is GML and SGML?
60Project 3
- Here are the requirements, which are also
available in Blackboard. - Discussion will XML really be the standard of
data transportation or data storage?
61Part 3 Database
- Instead of listing it as Chapter 3, it is listed
as Part 3, which shows that this is a big issue.
62Chapter 1 Database History
- Hierarchical database
- Network database
- Relational database
- Object-oriented database
- Object-oriented relational database
- XML database
- etc
63Relational Database
- The major database in use.
- Based on the relations between data items.
- Key element tables.
- Available relational databases Oracle, DB2,
Sybase, MS SQL Server, Access, MySQL, etc. - A site about evaluation.
- The instructors database work.
64Records and Attributes
- A table has multiple records, each has multiple
values. - For example.
- The attributes define the data types. All data
in that column must conform to the given data
types.
65Primary Key
- The primary key of a relational table uniquely
identifies each record in the table. It can
either be a normal attribute that is guaranteed
to be unique (such as Social Security Number in a
table with no more than one record per person) or
it can be generated by the DBMS (such as a
globally unique identifier, or GUID, in Microsoft
SQL Server). Primary keys may consist of a single
attribute or multiple attributes in combination - For example, in the table example, the primary
key is Student. - Every table must have Primary Key defined.
66Primary Key (2)
- Guess what would be the Primary Key in the SJC
database for students? - Will it be ok to use your name (last name and
first name) as the primary key?
67Create a table for
- Smith, Jack, male, 8/15/1989, 421865241, Forrest,
Shoplifting, Linda Luke, (860)321-9086, 105. - Marsa, Rose, female, 7/1/1988, 3245691877, Jones,
Dog fighting, Nancy Charles, (860)321-9088, 106. - Lese, Sam, male, 3/21/1986, 425423785, Hartford,
Dwell breaking, Linda Luke, (860)321-9086, 105. - Haly, Rachel, female, 3/25/1989, 423671841,
Hartford, misconduct, Linda Luke, (860)321-9086,
105. - Horse, James, male, 11/2/1987, 765213456, Lama,
misconduct, Nancy Charles, (860)321-9088, 106. - Lincoln, George, male, 10/5/1988, 324342342,
Jones, fighting, Linda Luke, (860)321-9086, 105. - Doom, Jade, female, 9/9/1988, 423213495,
Hartford, misconduct, Nancy Charles,
(860)321-9088, 106.
68TableS
- Surely we will deal with multiple database tables
concerning any complete datasets. - When dealing with complicate datasets, first
thing is to categorize the data into groups with
each group represented by a table. - The second thing is to find and build the
relationships between the tables.
69Analyze the data
- How many categories we have?
- Lets use UML to clear the data relationship!
- UML is Unified Modeling Language which arises in
1990s. It derived from the three greatest minds
of system modeling. - It is the standard language used to analyze
system design.
70Practice
- The UML diagram
- What tables you would construct for the data in
the XML file? - Do this exercise in class.
71Relationship
- Now lets talk about the relationship types
- One-to-One
- One-to-many vs many-to-one
- Many-to-many
72One-One
SSN
Person
1
1
73One-Many
- Bank accounts ? ? person (one person can have
multiple accounts, but one account belongs to one
person/family).
Bank account
person
1
74Many-Many
- Course-Student. A student may take multiple
courses, and a course may be taken by multiple
students.
75Foreign Key
- A foreign key is a relationship or link between
two tables which ensures that the data stored in
a database is consistent. - The foreign key link is set up by matching
columns in one table (the child) to the primary
key columns in another table (the parent). - Referential Integrity
76Foreign Key Example 1
Table Students
PK
Basket Ball players
studentID First name Last name Major SSN Gender DO
B
playerID First name Last name Position number
PK
One-to-one
parent
child
77Foreign Key Example 2
- Given a table about instructors whose columns are
ID, first name and last name. - Suppose the basic information of a offered course
is the instructor and the course name.
78Contd
1
Course name Instructor
ID First name Last name
One-Many
79Contd
80Exercise in Depth
- UML diagram of the exercise.
- Now, how to define the tables that can properly
represent the UML diagram?
81Common Rules
- One object (entity) one table
- One attribute one column
- Additional PK optional in some cases.
82How to define Relations between Tables?
- First of all, we have to know that Parents come
before children. Tables that can be built
without referencing other tables/data could be
used as parent table. - For example, student table vs basket ball player
table.
83Relations contd
- In case of One-One relation, the parent table is
the table that can be built without referencing
any data in the child table. The child table
must be the table that references data in the
parent table.
84Example
studentID First name Last name Major SSN Gender DO
B
playerID First name Last name Position number
85Relation contd
- In case of One-Many, the One must be the parent
table, and the Many must be the child table
86Example
child
parent
BookID Title Author Publish year Publisher ID
PublisherID Name Address
Many-One
87Many-Many
- It is pretty hard to express the Many-Many
relations between two tables. - For example, students ? ? Courses relationship.
- How are we going to do it?
88Solution
- Make use of another table! In this case, we have
three tables. One for students only, one for
courses only, and one to link students with
courses.
89Solution Example
studentID lastname firstname DOB gender
Course Title Location
StudentID Course
90The full table construction
- Lets work on this data to build the whole
tables! - Now, lets do this project 4!
91Sword, a real application
- Publicly information about Sword.
- A success story of data representation, storage
and management in Mississippi. - Please form 2 or 3 groups for the coming projects
since they are kind of complicated. Inform me of
the group members in the next class. Thanks.
92Discussion of Sword in Class
93Chapter 2 Access Basics I
- Please form 2 or 3 groups to for the coming
projects since they are kind of complicated.
Inform me of the group members in the next class.
Thanks. - Every student is supposed to collect at least 2
restaurant menus of the Hartford area. Keep them
for later use.
94Basics (1)
- Open and save an Access database.
- Create a table in Design View.
- To create good tables, we need to understand our
data first. Lets have a look at the existing
data in next slide.
95Try
- Create a table to hold the information below?
- Smith, Jack, male, 8/15/1989, 421865241, Forrest,
Shoplifting, Linda Luke, (860)321-9086, 105. - Marsa, Rose, female, 7/1/1988, 3245691877, Jones,
Dog fighting, Nancy Charles, (860)321-9088, 106. - Lese, Sam, male, 3/21/1986, 425423785, Hartford,
Dwell breaking, Linda Luke, (860)321-9086, 105. - Haly, Rachel, female, 3/25/1989, 423671841,
Hartford, misconduct, Linda Luke, (860)321-9086,
105. - Horse, James, male, 11/2/1987, 765213456, Lama,
misconduct, Nancy Charles, (860)321-9088, 106. - Lincoln, George, male, 10/5/1988, 324342342,
Jones, fighting, Linda Luke, (860)321-9086, 105. - Doom, Jade, female, 9/9/1988, 423213495,
Hartford, misconduct, Nancy Charles,
(860)321-9088, 106.
96Try contd
- First, primary key!
- Continue the building of one table for all the
data. - After done, save the work and give the table a
sensible name.
97Create Table wizard
- Lets explore the table creation function of
Access we can create table by Wizard, i.e. with
templates.
98Create Multiple Tables
- Based on the UML diagram of the data, lets
create multiple tables.
99Normalization
- Normalization in database means to remove the
redundant data to improve data storage
efficiency, data integrity and scalability. - It is essential
- Good online explanation
1003 Level Normalization
- The first level of normalization removes
redundant data horizontally, i.e. no repeated
columns. - The second level of normalization removes
redundant data vertically, i.e. no repeated data
in rows. - The third level of normalization organize data
that does not depend on the primary key into
another table.
101Normalization
- Totally there are 5 levels of normalization.
- It is absolutely necessary to apply the 1st and
2nd levels of normalization. - The 3rd level is applied sometimes.
- Dont bother with the 4th or 5th levels of
normalization
102Exercise
- What is the normalization level of the database
constructed?
103Basics (2) Simple Query
- Based on the constructed table, lets have some
fun with Query. - Query is a programming language called SQL
(structured query language). - SQL is a standard interactive and programming
language for getting information from and
updating a database. - Click here to learn more?
104(No Transcript)
105Create Query
- Create Query in design view
- Create Query by using wizard
- View the result sheet.
106Query Syntax
- Though we now know how to create simple queries
graphically, we still need to understand the
syntax. - SELECT sth FROM somethere.
Select from classes Select ID from
classes Select classes.ID, lastname from classes
107Set Conditions
- SELECT something FROM somewhere WHERE
conditions-are-met - Select from students where gender0
- Select from students where lastnameSmith
- Select from students where DOB between
1/1/1988 and 1/1/1990
108Set Conditions
- Select from students where lastname like
Smi - Select from students where lastname like
smi - SELECT FROM students WHERE gender0 AND
lastname like smi - Be aware in standard SQL, LIKE smi
109JOIN
- In many cases, we need to fetch data from
multiple tables. Thus, we need to bind together
the data from the tables. The binding is based
on some keys, usually the primary key or some
other unique data items. - Good online material (but be aware that this is
for standard SQL, not for Access!) - FOR Microsoft inquiry, please go to
http//msdn.microsoft.com/
110Join in Access
- Select sth1, sth2 from table1 INNER JOIN table2
ON table1.key1 table2.key2. - For example
- Select students. from (students INNER JOIN
studentscourses ON students.ID
studentscourses.studentID) where
studentscourses.courseNumComp200
111Other JOINS
- There are two different types of JOIN
- INNER JOIN
- OUTER JOIN
- LEFT JOIN
- RIGHT JOIN
- Lets not deal with OUTER JOIN in this class
to make it simple.
112INNER JOIN
- INNER JOIN only join the records that both tables
have the corresponding key!. - See the MSDN explanation
113Sort the Results
- You can order the results in ascending or
descending order. - Select from students order by studentID desc
- Select from students order by lastname (if it
is ascending order, you dont need to specify it)
114Subquery
- Inside a query, we can have another query to
provide some information for a condition, i.e. we
have subquery(s) inside a query. - Select from students where studentID in (select
studentID from studentscourses where
coursenumberComp200)
115Functions
- Access query could use built-in functions. For
example, MAX, MIN, COUNT, etc. Lets experience
COUNT. - Question how to find the number of students who
are taking courses currently in the school?
116Others
- SO far, we have been dealing with SELECT queries.
There are other types - CREATE create tables
- INSERT insert rows
- DROP drop tables
- DELETE delete rows
- ALTER - change the table structures
- Etc.
117Sample Database
- Here is a sample database with some queries
constructed. Might be useful as references. - Remember that this class is not only for
database, so we cannot go very deep into database
issues. If you have more interests in database,
I may be able to offer a class specifically on
database.
118Project 5
- Project 5 requests you to construct a database
for a group of restaurant. Please use UML
diagram to analyze the data first, then construct
your database. Also, please provide some
queries. -- Imaging that you are provide a
hotline services for customer inquiries about
food services in Hartford area.
119Part 4 Bioinformatics
- What is bioinformatics?
- The study of the application of computer and
statistical techniques to the management of
biological information - The science of creating and managing biological
databases to keep track of, and eventually
simulate, the complexity of living organisms. - There exist different definitions, though.
120The Possible Role of Bioinformatics?
- Look over the history of biology, different
approaches are used over the time. - Initially Guessing ? Observation ? Dissection.
- Mendal started genetic experiments.
- Biochemists used organics to clear out the
metabolic pathways. - Molecular biology is another approach now used to
decode the life secrets. - Is it the time for bioinformatics as another
approach?
121Several Foundations of Bioinformatics
- Lives are from the same ancestors, either
evolved or created. That means that knowledge
obtained on one form of life may be applied to
other forms. In fact, molecular biology started
from bacteria, then yeast, then mammal. ?
database - Publicly available data resources.
- Human Genome Project
122Publicly Resources
- I am not sure how many biological research
laboratories we have in the world, it must be
MANY MANY. - No other science has equal or even close amount
of research laboratories. - The largest amount of research funds from
government, states, private corporations, etc.
123Most famous Agencies
- NIH (National Institute of Health)
- WHO (World Health Organization)
- Others
124Huge Amount of Information
- All the scientists in the world generated large
amount of scientific information, and it is
likely much of them is repeated. - Communication among scientists become extremely
important. - That is why there are so many publicly available
biological resources. - Internet plays a critical role in the information
sharing.
125Internets Information
- Access to information for anyone with an Internet
browser. - The data stored in centralized database us
redundant by a factor of about 2.5, which
provides a quality control. - Information from yeast (for example) could be
helpful in finding/understanding homologous
genes/pathways in humans (comparative genomics).
126Human Genome Project
- HGP.
- Without HGP, there is no real Bioinformatics.
- Bioinformatics boosted up after large amount of
Human Genome are decoded ? how to use these DNA
information? ? Computer technologies!
127Bioinformatics and Evolution
Mutations
128Mutations
- Mutations that occur in germ cells will be passed
on to the next generation, like any other DNA
sequences. - So, as time and generations go by, a DNA sequence
will acquire more and more mutations and resemble
less and less the original DNA sequence.
129Need to know where from
- From an evolutionary perspective, we cannot know
where we are going unless we know where we have
been. Before, the study of human evolution was
largely the province of paleoanthropologists who
studied the fossil record. - However, gene comparisons now become the major
and more accurate techniques ? using computer
technologies/bioinformatics
130Do you know
- We all started from Africa?
- Using the Mitochondrial DNA analysis among women
from different nations, it is found that African
people have larger variations in DNA sequence ?
oldest group has the greatest genetic diversity ?
African is the oldest population ? the ancestor.
131Bioinformatics with AIDS
- Analysis of the human genome guides AIDS
research. Some persons long-infected with HIV
have not shown any symptoms of the disease.
Studies found that these people possess a variant
of a receptor CCR5 ? Rarely in Asian and African
? guess it may come to European in 14th century.
132Tools of Bioinformatics
- Gene Predication Software
- Sequence Alignment Software
- Molecular Phylogenetics
- Molecular Modeling and 3-D Visualization.
133NCBI
- National Center for Biotechnology Information.
- PubMed (Medline)
- Entrez
- BLAST
- OMIM
- Books
- TaxBrowser
- Structure
134PubMed
- Access to the Medline database ? largest
biomedical literature source. - Medline database contains citations and abstracts
from more than 4600 biomedical journals published
in USA and other countries. - Searches are commonly conducted using a
keyword(s), author names, publication date,
and/or journal titles.
135Entrez
- A search and retrieval system that integrates all
of the databases available at NCBI. These
databases include nucleotide sequences, protein
sequences, genomes, molecular structure and
PubMed. - GenBank, DNA DataBank of Japan, European
Molecular Biology Laboratory make up the
International Nucleotide Sequence Database
Collaboration. These organizations exchange data
every day. - Search for Bcl2 as an example.
136BLAST
- Basic Local Alignment Search Tool.
Sequence 1 AGTTCGATAGCTAAGGTCGG Sequence
2 AGTTCGATAGCTATGGTCGG
137BLAST
Sequence 3 AGTTCGATAGCTAAGGTCGG Sequence
4 AGTTCGATAGCTAGGTCGGG
138BLAST Another Look
Sequence 3 AGTTCGATAGCTAAGGTCGG Sequence
4 AGTTCGATAGCTAGGTCGG
139Use BLAST
- Click here.
- Lets choose blastn.
- Now, lets practice its uses.
140OMIM
- Online Mendelian Inheritance in Man
- It is a database containing information about
human genes and genetic disease. This resources
is often used by physicians and researchers
interested in genetic diseases.
141Books
- NCBI collaborates with authors and publishers to
create a virtual bookshelf.
142TaxBrowser
- The taxonomy site contains a classification of
all the organisms that are represented by
sequences in the public databases, including
model organisms commonly used in molecular
biology.
143Structure
- The structure site features the Molecular
Modeling Database (MMDB), which contains
macromolecular 3-D structures as well as tools to
analyze them. Included in the MMDB are
experimentally determined structures obtained
from the protein data bank.
144Cn3D4.1
- You can download it.
- It reads MMDB instead of PDB file. This is
because MMDB will ensures the correctness of the
read PDB file. - The Link
145Applications of Bioinformatics
- Forensic Science
- Agriculture
- Medicine
- Pharma/Biotechnology
- Environmental Science
- Ethical Legal, and Social ISsues
146Forensic Science
- Minisatellites consists of short DNA sequences
that repeat in tandem. The number of repeats
the sequence within each repeat can exhibit wide
variation in a population. Techniques based on
this were developed to identify individuals.
E.g. FBI established Combined DNA Index System
(CODIS) that contains profiles of convicted
offenders.
147Forensic Science
- DNA testing is now the standard technique for
confirm paternity. - Is also a technique to identify criminals and
victims. - Computer technology is essential to search
through the database for the identification.
148Agriculture
- Genome projects for major crop plants are well
underway - Pest control
- Seed quality
- Plant micronutrients (golden rice)
- Etc.
149Medicine
- The ability to correlate genetic data with
medical records promises to improve our
understanding of disease and improve treatments. - Microarray ? cancer classification
- Associating SNPs with disease helps scientists to
identify genes that play roles in disease
progression.
150Pharma/Biotechnology
- Bioinformatics is providing a complete list of
candidate genes for drug discovery. The tools of
functional genomics are being used to establish
the metabolic roles played by the candidate gene
products. - Pharmaceutical companies are using bioinformatics
to search for new antibiotics.
151Contd
- Advances in genomics are expanding the range of
drug targets and are shifting the discovery
effort from direct screening programs to rational
target-based drug designs.
152Environmental Sciences
- Global biodiversity.
- Global Biodiversity Information Facility (GBIF)
- How to analyze these diversity and make use of
them. - Computer software to monitor environmental
changes, via birds and other animals behaviors.
153Ethical, Legal and Social Issues
- Anonymous databases ? include nonidentifiable
genetic data. - Non-anonymous databases ? its data could be
linked to individuals. - An ethical concern most relevant to non-anonymous
databases is Informed Consent.
154Informed Consent
- Informed consent is the ethical practice of
respecting individual autonomy and protecting an
individual from harm. It refers to a process
whereby an individual freely and knowingly weighs
the risks and benefits of donating a tissue or
DNA sample for research purposes.
155Privacy Confidentiality
- Personal privacy is an important aspect of
informed consent. Privacy is the right to
control access to information about oneself. - Confidentiality is the obligation for those who
obtain information about individuals to protect
the privacy of that information.
156More
- If society is to gain the most from genomic
biology, then the public must be able to
rationally consider scientific issues. They
should not place a blind trust in scientists, nor
should they dismiss new technologies out of hand.
157In-Class Exercise
- Human Genome is sequenced via the shortgun
approach in which human chromosomes were randomly
cut into pieces. - Each DNA pieces are sequenced separately.
- Computer technology is then used to find the
overlap and construct the contiguous sequence.
158In-Class Exerices
- Group 1
- Group 2
- Group 3
- Each group will constitute two fragments and all
groups work together for the final sequences. - For simplicity, we are dealing with only one
strand for simplicity.