Lecture 20: Macroevolution

1
Lecture 20 Macroevolution
Readings Ch. 25.3 (but many Figures used from
other chapters)
Two explanations for macroevolution
gradualism, punctuationalism Gradual
ism
continental drift analogy gradual changes in DNA
sequences accumulation of large differences in
real time in viruses the molecular clock
hypothesis morphological stages as gradual steps
Punctuationalism
the punctuated equilibrium model, with or without
speciation Can small genetic changes produce
large morphological effects?
allometry heterochrony homeotic
mutations Hox genes Evolution is not goal
oriented
2
Charles Darwins explanations for macroevolution
gradualism His proposal is that macroevolution is
just the accumulation of the effects of
microevolution. This is essentially in part what
Darwin meant by descent with modification. We
now have a better appreciation that a large
fraction of evolutionary change may accumulate in
speciation events, if the punctuation model is
correct.
3
An analogy to show how small changes can
gradually accumulate to produce huge differences
continental drift. Continental drift, which is
the movement of the continents over time as huge
crustal plates on the surface of the earth move
with respect to each other. See Figs. 26.18-20.
Plates can separate, driving speciation, or slide
under one another (as Darwin in effect saw),
raising mountains.
4
Fig. 26.18. The crustal plates and their
patterns of movement. Note that South American
and Africa were once one continent, now divided.
5
We can actually see the gradual movement of
plates in almost real time now. Movement of the
big island of Hawaii, as measured using GPS
(Geographic Positioning System) From the Jet
Propulsion Laboratory (http//sideshow.jpl.nasa.go
v/mbh/series.html )
6
The point small, gradual changes add up to a lot
of plate movement given a few million years.
7
Back to a biological example, but one using rapid
but still basically gradual change evolution of
influenza virus. This example is from an
influenza virus hemagglutinin (coat protein) gene
study.
Texas 93 sequence at top
111111111122222222223333333333444444444 1234567890
12345678901234567890123456789012345678 caaaaacttcc
cggaaatgacaacagcacggcaacgctgtgcctggga caaaaccttccc
ggaaatgacaacagcacagcaacgctgtgcctggga 1 2 3 4
5 6 7 8 9 10 11 12 13 14 15 16
China 85 sequence at bottom
time
Above are the first 48 bases of the gene - 16
codons that code for the first 16 amino acids -
in which there are 2 changes. There are
approximately 41 total changes between these two
sequences in the entire 987 bases. Note that this
is in the form of a DNA sequence for technical
reasons.
8
A really remarkable tree, showing the
accumulation of a lot of sequence difference, one
base at a time Haemaglutinin gene evolution in
influenza type A strains from 1985 - 1996. This
represents 1348 base substitutions total (with a
length of 987 bases)!
From Bush et al. 1999. Positive Selection on the
H3 Hemagglutinin Gene of Human Influenza Virus A.
Mol. Biol. Evol. 1614571465. 1999
9
The preceeding tree is a type called a phylogram,
in which the branch lengths tell us about the
amount of evolutionary change.
original
ATTAGATTAGCGATCGCTTTAATGGGGTAG
mutant 1
ATTAGATTAGCGATCGCATTAATGGGGTAG
mutant 2
ATTAGATTAGCGATCGCATTAATCGGGTAG
T to A
mutant 3
G to C
ATTAGATAAGCGATCGCATTAATCGGGTAG
T to A
10
But this kind of tree graph, in which the lines
do not tell us anything about the amount of
change along each branch, is called a cladogram.
ATTAGATTAGCGATCGCTTTAATGGGGTAG
ATTAGATTAGCGATCGCATTAATGGGGTAG
T to A
ATTAGATTAGCGATCGCATTAATCGGGTAG
G to C
ATTAGATAAGCGATCGCATTAATCGGGTAG
T to A
11
Figure 22.16 Comparison of a protein found in
diverse vertebrates
Over greater time spans, we see that gradualism
explains the large sequence differences between
the homologous genes of very different organisms.
12
Each dot represents the number of base
substitutions (changes) between a given pair of
species, out of about 3000 bp. In the
hypothetical example below, there are 2 changes
in 15 bp.
species A ATAAGGCGTATGGTA species B
ATAGGGCGTATGCTA
The molecular clock hypothesis - if gradualism
occurs at a regular rate, we may be able to date
events from molecular divergence.
sp. B
sp. A
millions of years
13
Fig. 24.14 A classic Darwiniam example of
gradualism for a morphological features - every
possible intermediate between the most simple and
the most complex structures are seen (as in
mollusc eyes).
14
But there is also evidence for what I am calling
punctuationalism - the idea that much change
happens in short spurts, and could be caused by
genes with large effects.
Fig. 24.13 Much debate has occurred on the issue
of whether macroevolution coincides with
speciation. But non-gradual evolution does not
have to coincide with speciation.
15
Fig. 24.15 Macroevolution often seems to involve
changes in the pattern of growth - of the pattern
of gene expression - of where genes are
expressed. Biologists have known for well over a
century that there are proportional changes in
the rates of growth of different parts of the
body. The study of these rates is called
allometry.
16
Fig. 24.16 Another critical aspect of
macroevolution is differences in timing of
growth of different parts - of the timing of gene
expression. This is called heterochrony. In
these salamanders, for example, foot growth
continues for a longer period of time in the
ground-dwelling salamander, resulting in longer
digits.
17
Figure 24.21 Paedomorphosis in an axolotl.
larval Tiger Salamander
adult Tiger Salamander
www.und.nodak.edu/org/ndwild/sally.html
Axolotl Tiger Salamander - larva with adult
reproduction
Fig. 24. 17 (current edition). A special case of
heterochrony is called - paedomorphosis - the
retention of juvenile characters in an adult.
18
Our understanding of how small changes in the
pattern of expression of genes can produce large
phenotypic changes has been increased by the
discovery of homeotic mutations - such as this
aristapedia mutation of Drosophila melanogaster,
in which the arista of the antenna develops into
a leg.
19
A class of homeotic genes that have been widely
studied in vertebrates are the Hox genes. (Such
genes contain a homeobox, which codes for a
particular protein domain that acts as a
transcription factor - it can bind to DNA in
particular sites and control gene expression).
Hox genes are very important in controlling early
development in vertebrates, and can be
illustrated by their effect on limb development.
20
Fig. 24.18 An example of a particular Hox gene
and its expression in limb buds in vertebrates.
21
Fig. 24.19
22
Figure 24.20 The branched evolution of horses
All phylogenies that include fossils show a
typical pattern of extensive branching and
extinction - not a linear progressive trend.
23
Lecture 20 Macroevolution
Readings Ch. 25.3 (but many Figures used from
other chapters)
Two explanations for macroevolution
gradualism, punctuationism Gadualism
continental
drift analogy gradual changes in DNA sequences
accumulation of large differences in real time in
viruses the molecular clock hypothesis
morphological stages as gradual steps
Punctuationalism
the punctuated equilibrium model, with or without
speciation Can small genetic changes produce
large morphological effects?
allometry heterochrony homeotic
mutations Hox genes Evolution is not goal
oriented