Title: Fabrice Camous
1On the use of Clustering and the MeSH Controlled
Vocabulary to Improve MEDLINE Abstract Search
Fabrice Camous
Co-auteurs Stephen Blott, Cathal Gurrin, Gareth
Jones and Alan Smeaton,
Directeurs de thèse Stephen Blott et Alan
Smeaton
School of Computing, Dublin City University
9 Mars 2005
CORIA 2005, Grenoble
Recherche financée par Enterprise Ireland
2Contexte de lexpérience notre projet
Recherche Web
Links
Links
Bases de données génomiques
Links
Links
Laboratoires humides
3Plan de lexposé
- Information Génomique Un environement hétérogène
riche en liens - Expérience et résultats
- Travail à venir
4Hétérogénéité de linformation génomique
Organismes Modèles
Gènes et protéines
Publications
AGGTCTCTAAGTCTTAGAGGTACCT
Séquences dADN
Humain
RSNVQABLFTNLGHBQTRRNVV
Résumés Biomédicaux
Séquences de protéines
Souris
Structures de protéines
VIH
5Liens explicites
Organismes Modèles
Gènes et protéines
Publications
AGGTCTCTAAGTCTTAGATTTACCT
AGGTCTCTAAGTCTTAGAGGTACCT
Homologie
Citation
Séquences dADN
Humain
Homologie
références inter-domaine
RSNVQABLFTNLGHBQTRRNVV
Résumés Biomédicaux
Séquences de protéines
Souris
Structures de protéines
VIH
6Liens implicites
Organismes Modèles
Gènes et protéines
Publications
AGGTCTCTAAGTCTTAGATTTACCT
AGGTCTCTAAGTCTTAGAGGTACCT
Similarité de séquence
Similarité textuelle
Séquences dADN
Humain
Similarité par ontologie
RSNVQABLFTNLGHBQTRRNVV
Résumés Biomédicaux
Séquences de protéines
Souris
Similarité par ontologie (MEDLINE)
Structures de protéines
VIH
7The Medical Subject Headings (MeSH)
1- Anatomy A 2- Organisms B 3- Diseases C
4- Chemicals and Drugs D 5- Analytical,
Diagnostic and Therapeutic Techniques and
Equipment E 6- Psychiatry and Psychology F
7- Biological Sciences G 8- Physical Sciences
H 9- Anthropology, Education, Sociology and
Social Phenomena I 10- Technology and Food and
Beverages J 11- Humanities K 12-
Information Science L 13- Persons M 14-
Health Care N 15- Geographic Locations Z
Body Regions
Research Papers
22,568 Unique Descriptors
Digestive System
Sense Organs
Human Indexer
Cells
MeSH Assignments
Blood Cells
Neurons
Stem Cells
MEDLINE database
Muscle Cells
8Liens implicites les résumés biomédicaux de
MEDLINE
PMID- 10506108 TI - Reduction of UV-induced skin
tumors in hairless mice by selective COX-2
inhibition. AB - UV light is a complete
carcinogen, inducing both basal and squamous
cell skin cancers. The work described uses
the selective COX-2 inhibitor celecoxib to
examine the efficacy of COX-2 inhibition in the
reduction of UV light-induced skin tumor
formation in hairless mice. UVA-340 sun lamps
were chosen as a light source that effectively
mimics the solar UVA and UVB spectrum.
Hairless mice were irradiated for 5 days a week
for a total dose of 2.62 J/cm(2). When 90
of the animals had at least one tumor, the
mice were divided into two groups so that the
tumor number and multiplicity were the same
(P lt 0.31). Half of the mice were then fed a
diet containing 1500 p.p.m. celecoxib. Tumor
number, multiplicity and size were then
observed for the next 10 weeks. Ninety-five
percent of the tumors formed were
histopathologically evaluated as MH -
Animals MH - Carcinoma, Squamous
Cell/enzymology/pathology/prevention
control MH - Cell Division MH - Cyclooxygenase
Inhibitors/therapeutic use MH - Female MH -
Immunohistochemistry MH - Isoenzymes/drug
effects/metabolism MH - Mice MH - Mice, Inbred
HRS MH - Neoplasms, Radiation-Induced/enzymology/
pathology/prevention control MH -
Prostaglandin-Endoperoxide Synthase/drug
effects/metabolism MH - Skin Neoplasms/enzymology
/pathology/prevention control MH -
Sulfonamides/therapeutic use MH - Support, U.S.
Gov't, P.H.S. MH - Ultraviolet Rays
- PMID- 10434051
- TI - Quantitative alterations of hyaluronan and
dermatan sulfate in the - hairless mouse dorsal skin exposed to
chronic UV irradiation. - AB - The quantitative alterations of hyaluronan
and dermatan sulfate in the - upper dermis (fibrous tissue) and the lower
dermis (adipose tissue) of the - hairless mouse skin chronically exposed to
the UV irradiation as - solar-simulating irradiation (lambda(max)
352 nm, UV distribution 300-310 - nm, 0.9 310-320 nm, 2.0 320-420 nm,
97.1) were evaluated. Hyaluronan and dermatan
sulfate contents in each part of dermis were
determined as follows skin sections on a glass
slide prepared by histological technique - were processed into the upper dermis and
the lower dermis with a small - surgical knife, and treated with
chondroitinase ABC and ACII in the - presence of bacterial collagenase. The
resulting unsaturated disaccharides - were determined by HPLC method. By applying
this method - MH - Animals
- MH - Chondroitin ABC Lyase
- MH - Collagenases
- MH - Deoxyribonucleases, Type II Site-Specific
- MH - Dermatan Sulfate/radiation effects
- MH - Disaccharides/analysis
- MH - Female
9Calcul de la valeur du lien inter-document MeSH
MeSH link weight
Analytical, Diagnostic and Therapeutic Techniques
and Equipment
- PMID- 10434051
- MH - Animals
- MH - Chondroitin ABC Lyase
- MH - Collagenases
- MH - Deoxyribonucleases, Type II Site-Specific
- MH - Dermatan Sulfate/radiation effects
- MH - Disaccharides/analysis
- MH - Female
- MH - Histological Techniques
- MH - Hyaluronic Acid/radiation effects
- MH - Mice
- MH - Mice, Inbred HRS
- MH - Skin/chemistry/pathology/ radiation
effects - MH - Swine
- MH - Ultraviolet Rays
PMID- 10506108 MH - Animals MH - Carcinoma,
Squamous Cell/enzymology/pathology/prevention
control MH - Cell Division MH - Cyclooxygenase
Inhibitors/therapeutic use MH - Female MH -
Immunohistochemistry MH - Isoenzymes/drug
effects/metabolism MH - Mice MH - Mice, Inbred
HRS MH - Neoplasms, Radiation-Induced/enzymology/
pathology/prevention control MH -
Prostaglandin-Endoperoxide Synthase/drug
effects/metabolism MH - Skin Neoplasms/enzymology
/pathology/prevention control MH -
Sulfonamides/therapeutic use MH - Support, U.S.
Gov't, P.H.S. MH - Ultraviolet Rays
Investigative Techniques
10Ensemble de Données de lexpérience
11Calcul des coefficients des vecteurs terms MeSH
12The cluster hypothesis
Closely associated documents tend to be relevant
to the same request.
van Rijsbergen 1979
13Partitional Clustering
Maximisation de la fonction critère hybride
14(No Transcript)
15(No Transcript)
16(No Transcript)
17Travail à venir
- Intégrer les qualifiers
- Optimization des coefficients des terms MesH pour
trouver les MeSH les plus discriminants (concepts
centraux, qualifiers, Hiérarchie, profondeur,
nombre de frères et soeurs)
18Références
- Funk and Reid, Indexing consistency in MEDLINE,
Bull Med Libr Assoc, 71(2) 176183, 1983. - Ganesan, Garcia-Molina and Widom, Exploiting
Hierarchical Domain Structure to Compute
Similarity, ACM Transactions on Information
Systems(TOIS), Jan 2003 . - National Library of Medicine, Medical Subject
Headings, MeSH. URL http//www.nlm.nih.gov/mesh/
meshhome.html, 2004. - Ontrup et al., A MeSH Term based Distance Measure
for Document Retrieval and Labeling Assistance,
Cancun, Mexico, Proc. of EMBC2003 (25th Annual
Int. Conf. of the IEEE Engineering in Med. and
Biol. Soc.), 2003. - Van Rijsbergen, C. J., Information Retrieval,
London Butterworths, 1979. - Wong et al., Generalized vector spaces model in
information retrieval, Proceedings of the 8th
annual international ACM SIGIR conference on
Research and development in information
retrieval, Montreal, Quebec, Canada, pages 18
25, 1985. - Zhao and Karypis, Criterion Functions for
Document Clustering, Experiment and Analysis,
University of Minnesota, MN, 2003.