Title: Leu, Trp 1/2 life 3 minutes Cys, Ala, Ser, Thr, Gly
1Fundamentals of Nucleic Acid Biochemistry RNA
- Donna Sullivan, PhD
- Division of Infectious Diseases
- University of Mississippi Medical Center
2DNA AND RNA BASIC STRUCTURE
3Repeating Nucleotide Subunits In DNA and RNA
4STRUCTURE OF RNA
- SUGAR
- Ribose
- Phosphate group
- Nitrogen containing base
- Adenine
- Guanine
- Cytosine
- Uracil
5THE NUCLEOTIDE RNA
OH OP-O-5CH2
BASE OH O
4C 1C H
H H H
3C 2C
OH 0H
Adenine Guanine Cytosine Uracil
6The Forms Of RNA Not Just Another Helix
- Does not normally exist as a double helix,
although it can under some conditions - Can have secondary structure
- Hairpins pairing of bases within 5-10 nt
- Stem-loops pairing of bases separated by gt50 nt
- Can have tertiary structure
- Pseudoknot, cloverleaf
7RNA Structures
8Structure Of RNA
9Structure of tRNA
10Structure of rRNA
11RNA Replication vs. DNA Replication
- RNA replication
- Requires no priming
- Has many more initiation sites
- Is slower (50100 b/sec vs. 1000 b/sec)
- Has lower fidelity
- Is more processive
12Transcription
- Transcription is the enzyme-dependent process of
generating RNA from DNA. - The process is catalyzed by a DNA-dependent RNA
polymerase enzyme. - Only coding segments of DNA (genes) are
transcribed. - Types of genes include structural genes (encode
protein), transfer RNA (tRNA), and ribosomal RNA
(rRNA).
13Transcription
- Transition from DNA to RNA
- Initiation Gene recognition
- RNA polymerase enzyme and DNA form a stable
complex at the gene promoter. - Promoter Specific DNA sequence that acts as a
transcription start site. - Synthesis of RNA proceeds using DNA as a
template. - Only one strand (coding strand) is transcribed,
the other strand has structural function. - Transcription factors are proteins that function
in combination to recognize and regulate
transcription of different genes. - Termination signal
14(No Transcript)
15RNA POLYMERASES
- Cellular RNA polymerase
- RNA pol I transcribes rRNA genes
- RNA pol II transcribes protein encoding genes
- RNA pol III transcribes tRNA genes
- Viral RNA polymerases
- Reverse transcriptase of retroviruses
- RNA dependent RNA polymerases of negative
stranded viruses
16RNA Polymerase Enzymes(DNA-dependent RNA
Polymerase)
- RNA Polymerase I transcribes most rRNA genes (RNA
component of ribosomes). - RNA Polymerase II transcribes structural genes
that encode protein. - RNA Polymerase III transcribes tRNA genes (for
transfer RNAs). - RNA Polymerase IV is the mitochondrial RNA
polymerase enzyme.
17(No Transcript)
18RNA TRANSCRIPTION
19General Organization of a Eukaryotic Gene
Promoter/Enhancer
20Gene Structure
21Nuclear Processing of RNA
- Chemical modification reactions (addition of the
5 CAP) - Splicing reactions (removal of intronic
sequences) - Polyadenylation (addition of the 3 polyA tail)
22Processing of mRNA
- In eukaryotes, the mRNA molecule that is released
after transcription is called precursor mRNA or
pre-mRNA. - It undergoes several changes before being
exported out of the nucleus as mRNA.
23Processing of mRNA
- 5 end is capped with a modified form of the G
nucleotide known as the 5 cap - At the 3 end, an enzyme adds a long series of A
nucleotides referred to as a poly-A tail - It serves to protect the mRNA from enzymes in the
cytoplasm that may break it down - The greater the length of the poly-a tail, the
more stable the mRNA molecule
24RNA Transcription and Processing
- The process of RNA transcription results in the
generation of a primary RNA transcript (hnRNA)
that contains both exons (coding segments) and
introns (noncoding segments). - The noncoding sequences must be removed from the
primary RNA transcript during RNA processing to
generate a mature mRNA transcript that can be
properly translated into a protein product.
25RNA Processing
- Capping of the 5-end of mRNA is required for
efficient translation of the transcript (special
nucleotide structure). - Polyadenylation at the 3-end of mRNA is thought
to contribute to mRNA stability (PolyA tail). - Once processed, the mature mRNA exits the nucleus
and enters the cytoplasm where translation takes
place.
26RNA ProcessingBiogenesis of Mature mRNA
27RNA ProcessingFundamentals of RNA Splicing
28RNA Processing Spliceosomes
- Ribonucleoproteins (snRNPs) function in RNA
processing to remove intronic sequences from the
primary RNA transcript (intron splicing). - Alternative splicing allows for the generation of
different mRNAs from the same primary RNA
transcript by cutting and joining the RNA strand
at different locations. - snRNPs are composed of small RNA molecules and
several protein molecules. - Five subunits form the functional spliceosome.
29RNA ProcessingAlternative Splicing of RNA
30Structural Genes Encode Proteins
- The majority of structural genes in the human
genome are much larger than necessary to encode
their protein product. - Structural genes are composed of coding and
noncoding segments of DNA.
31Structural Genes Encode Proteins
- The structure of a typical human gene includes
informational sequences (coding segments termed
exons) interrupted by noncoding segments of DNA
(termed introns). - The exon-introncontaining regions of genes are
flanked by non transcribed segments of DNA that
contribute to gene regulation.
32Factors That Control Gene Expression Include
- Cis elements are DNAsequences.
- Trans elementsare proteins.
33Control of Gene Expression
- Primary level of control is regulation of gene
transcription activity. - TATA box contained within the gene promoter
provides binding sites for RNA polymerase. - Enhancer sequences can be sited very far away
from the gene promoter and provide for
tissue-specific patterns of gene expression.
34Gene Enhancer Sequences
35Protein binding sequences in the Promoter region
36Gene Regulation Two types of regulation
- Negative regulation
- Substrate induction (lac operon) gene OFF unless
substrate is present - End product repression (trp operon) gene OFF if
end product is present - Common in bacteria
- Positive regulation
- Gene is OFF until a protein turns it ON
- Regulatory proteins turn gene ON
- Occurs in eukaryotes
37Negative Regulation
38Positive Regulation
39Lac Operon
- Operon
- Gene organization in bacteria in which several
proteins are coded by one mRNA - Allows all proteins to be controlled together
40Differences Between Prokaryotes And Eukaryotes
- Prokaryote gene expression typically is regulated
by an operon, the collection of controlling sites
adjacent to protein-coding sequence. - Eukaryotic genes also are regulated in units of
protein-coding sequences and adjacent controlling
sites, but operons are not known to occur. - Eukaryotic gene regulation is more complex
because eukaryotes possess a nucleus
(transcription and translation are not coupled).
41Two Categories Of Eukaryotic Gene Regulation
- Short-term - genes are quickly turned on or off
in response to the environment and demands of the
cell. - Long-term - genes for development and
differentiation.
42Eukaryote Gene Expression Is Regulated At Six
Levels
- Transcription
- RNA processing
- mRNA transport
- mRNA translation
- mRNA degradation
- Protein degradation
43Transcription Control Of Gene Regulation
Controlled By Promoters
- Occur upstream of the transcription start site.
- Some determine where transcription begins (e.g.,
TATA), whereas others determine if transcription
begins. - Promoters are activated by highly specialized
transcription factor (TF) proteins (specific TFs
bind specific promoters). - One or many promoters (each with specific TF
proteins) may occur for any given gene. - Promoters may be positively or negatively
regulated.
44Transcription Control Of Gene Regulation
Controlled By Enhancers
- Occur upstream or downstream of the transcription
start site. - Regulatory proteins bind specific enhancer
sequences binding is determined by the DNA
sequence. - Loops may form in DNA bound to TFs and make
contact with enhancer elements. - Interactions of regulatory proteins determine if
transcription is activated or repressed
(positively or negatively regulated).
45Chromosome Structure, Eukaryote Chromosomes, And
Histones
- Prokaryotes lack histones and other structural
proteins, so access to the DNA is
straightforward. - Eukaryotes possess histones, and histones repress
transcription because they interfere with
proteins that bind to DNA. - Verified by DNase I sensitivity experiments
- DNase I readily degrades transcriptionally active
DNA. - Histones shield non-transcribed DNA from DNase I,
and DNA does not degrade as readily.
46Chromosome Structure, Eukaryote Chromosomes, And
Histones
- If you experimentally add histones and promoter
binding proteins histones competitively bind to
promoters and inhibit transcription. - Solution transcriptionally active genes possess
looser chromosome structures than inactive genes. - Histones are acetylated and phosphorylated,
altering their ability to bind to DNA. - Enhancer binding proteins competitively block
histones if they are added experimentally with
histones and promoter-binding TFs. - RNA polymerase and TFs step-around the
histones/nucloesome and transcription occurs.
47Genomic Imprinting(Silencing)
- Methylation of DNA inhibits transcription of some
genes. - Methylation usually occurs on cytosines or
adenines. - 5-methyl cytosine
- N-6 methyl adenine
- N-4 methyl cytosine
- CpG islands are sites of methylation in human
DNA. - CpG Island
ggaggagcgcgcggcggcggccagagaaaaa gccgcagcggcgcgcg
cgcacccggacagccgg cggaggcggg...
48DNA Methylation And Transcription Control
- Small percentages of newly synthesized DNAs (3
in mammals) are chemically modified by
methylation. - Methylation occurs most often in symmetrical CG
sequences. - Transcriptionally active genes possess
significantly lower levels of methylated DNA than
inactive genes. - A gene for methylation is essential for
development in mice (turning off a gene also can
be important). - Methylation results in a human disease called
fragile X syndrome FMR-1 gene is silenced by
methylation.
49Hormone Regulation Example Of Short-term
Regulation Of Transcription
- Cells of higher eukaryotes are specialized and
generally shielded from rapid changes in the
external environment. - Hormone signals are one mechanism for regulating
transcription in response to demands of the
environment. - Hormones act as inducers produced by one cell and
cause a physiological response in another cell.
50Hormone Regulation Example Of Short-term
Regulation Of Transcription
- Hormones act only on target cells with hormone
specific receptors, and levels of hormones are
maintained by feedback pathways. - Hormones deliver signals in two different ways
- Steroid hormones pass through the cell membrane
and bind cytoplasmic receptors, which together
bind directly to DNA and regulate gene
expression. - Polypeptide hormones bind at the cell surface and
activate transmembrane enzymes to produce second
messengers (such as cAMP) that activate gene
transcription.
51Examples Of Mammalian Steroid Hormones
52Hormone Regulation
- Genes regulated by steroid hormones possess
binding regions in the sequence called steroid
hormone response elements (HREs). - HREs often occur in multiple copies in enhancer
sequence regions. - When steroid is absent Receptor is bound and
guarded by chaperone proteins transcription
does not occur. - When steroid is present Steroid displaces the
chaperone protein, binds the receptor, and binds
the HRE sequence transcription begins.
53Model Of Glucocorticoid Steroid Hormone Regulation
54RNA Processing Control
- RNA processing regulates mRNA production from
precursor RNAs. - Two independent regulatory mechanisms occur
- Alternative polyadenylation where the polyA
tail is added - Alternative splicing which exons are spliced
- Alternative polyadenylation and splicing can
occur together. - Examples
- Human calcitonin (CALC) gene in thyroid and
neuronal cells - Sex determination in Drosophila
55Alternative Polyadenylation And Splicing Of The
Human CACL Gene In Thyroid And Neuronal Cells
56mRNA Transport Control
- Eukaryote mRNA transport is regulated.
- Some experiments show 1/2 of primary transcripts
never leave the nucleus and are degraded. - Mature mRNAs exit through the nuclear pores.
57mRNA Transport Control
- Unfertilized eggs are an example, in which mRNAs
(stored in the egg/no new mRNA synthesis) show
increased translation after fertilization). - Stored mRNAs are protected by proteins that
inhibit translation. - Poly(A) tails promote translation.
- Stored mRNAs usually have short poly(A) tails
(15-90 As vs 100-300 As). - Specific mRNAs are marked for deadenylation
(tail-chopping) prior to storage by AU-rich
sequences in 3-UTR. - Activation occurs when an enzyme recognizes
AU-rich element and adds 150 As to create a full
length poly(A) tail.
58mRNA Degradation Control
- All RNAs in the cytoplasm are subject to
degradation. - tRNAs and rRNAs usually are very stable mRNAs
vary considerably (minutes to months). - Stability may change in response to regulatory
signals and is thought to be a major regulatory
control point. - Various sequences and processes affect mRNA
half-life - AU-rich elements
- Secondary structure
- Deadenylation enzymes remove As from poly(A) tail
- 5 de-capping
- Internal cleavage of mRNA and fragment degradation
59Post-translational Control - Protein Degradation
- Proteins can be short-lived (e.g., steroid
receptors) or long-lived (e.g., lens proteins in
your eyes). - Protein degradation in eukaryotes requires a
protein co-factor called ubiquitin. - Ubiquitin binds to proteins and identifies them
for degradation by proteolytic enzymes. - Amino acid at the N-terminus is correlated with
protein stability and determines rate of
ubiquitin binding. - Arg, Lys, Phe, Leu, Trp 1/2 life 3 minutes
- Cys, Ala, Ser, Thr, Gly, Val, Pro, Met 1/2 life
20 hours
60Epigenetics
- Non-sequence specific, heritable traits
- Transcriptional gene silencing (TGS)
- Imprinting
- X-inactivation
- RNA-induced transcriptional silencing (RITS)
- Post-transcriptional gene silencing (PTGS)
- RNA-induced silencing complex (RISC)
- G quartets
- Post-translational protein-protein interactions
61RNAi
- First described in C. elegans
- Injecting antisense RNA into oocytes (ssRNA that
is complementary to mRNA) - Silences gene expression
- Also injected dsRNA into oocytes found it was 10X
more potent in inhibiting expression - Term RNAi
62RNAi
- Higher eukaryotes produce a class of small RNAs
that mediate silencing of some genes - Small RNAs interact with mRNA in the 3UTR and
this results in either mRNA degradation or
translation inhibition - Controls developmental timing in at least some
organisms - Used as a mechanism to protect against invading
RNA viruses (plants) - Controls the activity of transposons
- Formation of heterochromatin
63Mechanism of RNA Interference
Step 1
Step 2
Nat Rev Genet. 2002 Oct3(10)737-47. Review.
64Epigenetics
- The study of mechanisms by which genes bring
about their phenotypic effects - Epigenetic changes influence Phenotype without
altering Genotype - Changes in properties of a cell that are
inherited but dont represent a change in genetic
information.
65A Histone Code?
- Modifications of histones (usually the amino
terminal tails) convey epigenetic information - Types of modifications
- Acetylation and methylation of lysine.
- Methylation of arginine
- Phosphorylation of serine
- Ubiquitination of lysine.
- The histone code hypothesis posits that serial
modifications provide a blueprint for reading
chromatin -for transcription, replication,
repair, and recombination.
66Remodeling Nucleosomes
- Changing the way nucleosomes bind to the DNA in
chromosomes is important to allow access to the
underlying DNA sequences during DNA replication,
repair, recombination, and transcription. - This occurs in three general ways
- Modification of the lys and Arg residues on the
histone tails decreases the grip of the
nucleosome on DNA and causes the nucleosome to
slide more easily. - Variant histones are added to pre-existing
nucleosomes - ATP-dependent protein remodelingcomplexes cause
nucleosomes to dissociate and/or slide along the
DNA.