Title: Analysis of HIV1 Pol Sequences in CSF and Plasma Shows Increasing Compartmentalization of Infection
1Analysis of HIV-1 Pol Sequences in CSF and
Plasma Shows Increasing Compartmentalization of
Infection with Disease Stage and ADC
- S.Sala, S. Spudich, M. Gisslen, L.Hagberg,
S.Presi, A.Bestetti, S.Bossolasco, S.Sala, R.W.
Price, P. Cinque - San Raffaele Scientific Institute, Milan, Italy,
- University of California San Francisco, USA,
- University of Goteborg, Sweden
2Background and Objectives
- Viral load studies of paired CSF and plasma
specimens indicate that HIV replication can be
variably segregated in these two compartments - Objective of this study was to evaluate the
extent of variation between CSF and plasma HIV-1
pol sequences and its association with
HIV-induced CNS disease, stage of infection and
patient variables
3Patients and Samples
Paired CSF and plasma from 107 HIV-infected
patients admitted at 3 clinical sites from 1994
to 2004 (Milan, San Francisco, Goteborg)
- According to anti-HIV treatment
-
- - RT inhibitors (RTI) 51
- - No RTI 56 (31 RTI naïve)
- - Protease inhibitors (PI) 23
- - No PI 84 (69 PI naïve)
- According to HIV-1 infection stage and CNS-D
- - Primary HIV infection 3
- - HIV and CNS asymptomatic 16
- - AIDS, CNS asymptomatic 11
- - ADC 0.5 14
- - ADC 1 14
- - CNS-OIs 49
4Methods
- 1. Amplification of RT and protease sequences by
RT-PCR of RNA extracted from CSF and plasma
samples (Milan, San Francisco) - 2. Direct sequencing of RT-PCR products (Milan,
San Francisco) -
- 3. Alignment of CSF/plasma sequences by ClustalX
- ? RT 546 nt ( 102/107 patients)
- ? protease 261 nt (88/107 patients)
- 4. Separate data analysis for RT and protease
calculation of diversity -
5Calculation of percent nucleotide diversity
G ? A SCORE 1
CSF
G
A
AGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAG
G
TGGCTTTGCCAGGA
PL
GAA
G
CTCTRTTAGATACAGGAGCAG
A
TGATACAGTATTAGAAGAGATGGCTTTGCCAGGA
R A / G SCORE 0.5
6RT CSF / plasma sequence diversity
CSF/ plasma diversity
7Protease CSF / plasma sequence diversity
CSF/ plasma diversity
8RT CSF / plasma sequence diversity in untreated
and treated patients
NO RTIs (n 54)
RTI-treated (n48)
CSF/ plasma diversity
9Protease CSF / plasma sequence diversity in
untreated and treated patients
NO PIs (n 67)
PI-treated (n 21)
CSF/ plasma diversity
10Correlation between CSF/plasma sequence diversity
and patient variables
11Summary
- CSF/plasma diversity increased with HIV-1
infection stage - CSF/plasma diversity was higher in patients with
ADCgt1 than in CNS asymptomatic or ADC O.5
subjects - These differences were more evident in untreated
patients - RT and protease CSF/plasma diversity correlated
with CSF HIV-RNA and CD4 cell count
12Conclusions
- CSF/plasma diversity increase with disease stage
and correlation with CD4 cells support the
presence of compartmentalized viral evolution
through the natural course of HIV-1 infection -
- Higher CSF/plasma diversity in ADC supports the
hypothesis of an autonomous HIV replication in
the CNS in this condition - Evaluation of CSF/plasma nucleotide diversity
might represent a marker to differentiate the
source of CSF virus -
13THANKS TO
Paola Cinque Simona Bossolasco
Bestetti Arabella Stefania Sala Silvia
Presi Richard W Price Serena Spudich
Magnus Gisslen Lars Hagberg
Department of Infectious Diseases San Raffaele
Hospital, Milan Department of
Neurovirology UCSF, USA Department of
Infectious Diseases University of Goteborg,
Sweden