Title: MER121: The most interesting junk in the genome
1MER121The most interesting junk in the genome
2Ancient Repeats Fossils of Dead Transposons
Ancient junk still present in genomes 22
of human genome 5 of mouse genome Expect
Alignable Neutral
2.6M AR sites in human
3AR some overlap with conserved islands.
1.6M UCSC Phastcons conserved islands in
human 2.6M AR sites 1.4 of the AR sites have
gt50bp overlap with a conserved Island (but
4.5 touch)
4MER121 most conserved CLASS of ancient repeats
How often does a human repeat type overlap
Phastcons element?
gt50bp overlap required class has gt10 instances
5AR Conservation of Big Words
How often do you see perfectly conserved words
with AR multiple alignment?
Some big words conserved
6MER121 Strikingly conserved big words
There are 20 instances of gt70bp perfect 4-way
(DHMR) conservation within ancient repeats
(UCSC/Blastz) MER121 7 L3
7 L3b 2 L2 2 MER102b
1 MIR87b 1 Less probable than
(1/2)70 P(perfect 4-way ungapped 4-way in
AR)1/2
7Is MER121 really a repeat?
412bp consensus in repeat masker RepBase entry
Jurka , 2001 Possible non-autonomous DNA
transposon. Lacks terminal signature inverted
repeat (need to double check)
880 of success is showing up
Much better retention compared to Mariner (DNA
transposon) MER121 Mariner Human
909 3292 Dog 858
2597 Mouse 461 366 Rat 422
310 Monodelphis has 1064 (3610
Mariner) Chicken has 3??? Update James Cuff
finds in 2X MER121
Mariner Dasypus 585 1934 Loxodonta
649 2755 Rabbit 541
898 Tenrec 487 1495
9MER121 prefers gene poor regions
There are 242 ancient repeat types with 500-4000
human instances MER121 ranked 20 lowest
median exonic density in 500Kb neighborhood 8
largest median distance to gene
starts Mariner 158 lowest median exonic
density close to typical genome density 151
largest median distance to gene starts
10Clusters of MER121 elements?
Suggestive, but perhaps coincidental 4 human
elements in 750Kb region that contains HoxD
11Largest Cluster 1.2Mb around INHBA
12 Human sites
10 are clearly alignable syntenically
Summary of INHBA The inhibin beta A subunit
joins the alpha subunit to form a pituitary FSH
secretion inhibitor. Inhibin has been shown to
regulate gonadal stromal cell proliferation
negatively and to have tumor-suppressor activity.
12Conservation of MER121 in 4-way multiple
alignments
P(human bases residing in ungapped alignment)
MER121 93 vs Mariner 66 P(perfect 4-way
ungapped alignment) MER121 72 vs Mariner
55
Need a coordinate system to compare different
sites Place on Repeat Masker consensus.
13Consensus takes predence
Place multiple alignment columns on RM consensus
Discard ones where human dos not align to
consensus
What fraction of aligned human sites have an
UNGAPPED column at position? PERFECT 4-way
MER121 (412bp)
Mariner (586bp)
Central region is most often present bases
100-241bp
14Place all multiple aligment columns
MER121 (412bp)
Mariner (586bp)
15Perfectly conserved words 1,2,4,6,8
MER121 (412bp)
Mariner (586bp)
16Predicted TF binding sites
17Conservation rate of different bases in central
region
18(No Transcript)
19L3b/LINE elements
20(No Transcript)
21(No Transcript)
22Total number of conserved 6-mers
23Conservation rate of 6-mers conditioned on
alignment
24Conservation rate of 6-mer in central region
CATATG
TCATCA
TTTGAT
25USF binding sites E-box
CTTAATTTTTAAACCCATGTGTATTTCAAGGGAAATTTAATCCATATGT
TTCTGATTCATTTACACTTAACTCATCAAAATGTTGTTTTGTAAGAGCT
26(No Transcript)
27Sort by Ungapped Coverage