Prokaryote Evolution

1
Prokaryote Evolution Diversity

• Dr Gillian Baker

2
Genetic Mutation

• REVISION What is mutation ?
• 5 types of mutation
• Transition/Transversion
• Mutations in Protein-coding
• Synonymous/Non-synonymous
• Deleterious, Advantageous, Neutral

3
Natural Selection

• Evolution is driven by 3 factors mutation,
  inheritance and selection.
• Natural Selection is the differential
  reproduction of genetically distinct genotypes
  within a population.
• e.g. a pool of water gets hotter due to global
  warming a bacterium with a mutation that allows
  it to live in hotter temperatures will survive
  and have more surviving offspring than those
  individuals that are less adapted.
• Darwinism - survival of the fittest

4
Fixation of Mutations

• The rate at which mutations occur is not entirely
  random. Hotspots exist (e.g. 5-TT-3 and
  pallindromes). The mutations that can be detected
  are only the neutral or advantageous ones
• Mutations can be fixed by selection OR genetic
  drift.
• Genetic Drift is solely due to chance effects.

5
Selectionist v Neutral Theory Arguments

• Neo-darwinsim selectionism is the only force
  able to drive evolutionism.
• Neutral theory (Kimura 1968) majority of
  molecular changes in evolution are due to the
  random fixation of neutral or nearly neutral
  mutations.
• The middle ground most variation is caused
  through neutral mutations, but selection plays a
  role in fixation of advantageous mutations and
  extinction of deleterious mutations.

6
Conserved and Variable Sites

• See Variability Map of ssu rRNA gene.
• CONSERVED positions - nucleotides do not vary in
  these positions. Mutations here may led to
  destruction of the molecule so are wiped out by
  selection.
• VARIABLE positions - these nucleotides are not
  essential to the function of the molecule and can
  vary in a clock-like manner.

7
Molecular Chronometers

• The number of base pair differences between two
  organisms is directly proportional to the time
  since the two organisms had a common ancestor.

Starts plateauing off when there are multiple
hits
(convergent, parallel and back
substitutions.)
Number bp differences
Years since divergence
8
Molecular Taxonomy

• 1960s amino acid sequencing (Zuckerandl
  Pauling).
• 1970s nucleic acid sequencing
• 1980s Universal Phylogenetic Tree (Woese)
• 1990s Refinement of PCR Technologies
• MOLECULAR TAXONOMY DATA
• re-evaluation of major branching patterns -
  Margulis - Woese
• re-assignment of taxonomic groups
• identification of new organisms and level of
  biodiversity

9
Universal Phylogenetic Tree
10
Molecular Microbial Taxonomy

• Dr Gillian Baker

11
Species Concept

• The Biological Species Concept
• One species CAN NOT breed with another species
  and produce fertile offspring
• BUT microbes DO NOT breed. So how do we define
  microbial species?
• 1. Morphological Biochemical Similarity
• 2. Genetic Similarity

12
Traditional Taxonomy

• What does it look like? (microscopy)
• Where does it live?
• What does it do? (assimilation studies)
• PROBLEM
• they all look the same!
• Some look the same, but are different.
• Some are different, but look the same.

13
Molecular Taxonomy

• To identify an organism on the basis of its
  proteins, RNA or DNA.
• A new species or strain arises as the result of
  a mutation(s) becoming fixed in a population.
• These mutations can be detected using Molecular
  Methods.

14
Culturability

• Microbes are small! To identify them you need to
  have more than one (or more than one copy of
  their DNA)
• Culturing microbes in vitro is a good way of
  making enough cells to work on.
• BUT - Less than 1 of the worlds microbes are
  culturable ! ......

15
The PCR Age

• Polymerase Chain Reaction - Cary Mullis - 1980s
• recipe for replicating DNA
• dNTPs (ATP, GTP, CTP TTP) occurs naturally
• Original Template in genome
• DNA Polymerase (see DNA replication
• Appropriate ions (especially Mg) in
  standard text book)
• Primase (to form primer)
• PCR is based on the natural process of DNA
  replication but allows specific and logarithmic
  replication of particular fragments or genes.

16
How to do a PCR

• 1 . Design a set of primers complementary to the
  DNA at either end of the gene/fragment of interest

F
R
AGGCCTGCATGGTCAA CCTTTCCGGACGTACCAGTTCCGT
17
How to do a PCR

• 2. Mix together ingredients Genomic DNA
  Primers dNTPs Salts and Buffers DNA
  Polymerase.
• 3. Put into a PCR machine _at_ 94C to denature
  genomic DNA into single-strands.
• 4. Cool to 50C to primers anneal to
  complementary genomic DNA.

18
How to do a PCR

• 5. Warm up to 72C to cause polymerase to
  catalyse elongation reaction (adding in
  complementary A, G, C T)
• 6. Start AGAIN. This time primers will also
  anneal to the newly synthesised strands

19
How to do a PCR

• 7. As this process continues cycle after cycle
  the number of small fragments increases
  proportionally to the original template until the
  majority of the product is copies of the gene or
  fragment between the two primers.

20
Thermostable Polymerase

• Normal DNA Polymerases found in humans and
  mesophilic microorganisms would not stand the
  heating and cooling needed to denature the DNA.
  (In the beginning they had to keep adding fresh
  polymerase after each annealing reaction.) So
  thermostable polymerases are used. Taq and Vent
  Polymerases are obtained from bacteria (Thermus
  aquaticus and hydrothermal vent bacteria) which
  live in environments of 70 - 95C.

21
So why did PCR make such a difference to
Microbiology?

• PCR has allowed us to amplify the genes of
  bacteria that do not grow in culture - i.e. most
  of them!
• Particularly useful for studying organisms that
  are difficult to grow in the lab - such as
  thermophiles, barophiles and psychrophiles.
• In theory we can amplify and use DNA from a
  single cell!

22
Methods for Identifying Organisms at Molecular
Level

• There are three main types of methods for
  identifying the differences (fixed mutations)
  between organisms
• 1. Total Genome Methods - e.g. DNA-DNA
• hybridisation chromosomal studies. ONLY
  suitable for higher organisms and culturable
  microbes.
• 2. Fragment length methods - infer differences
  in genomic DNA prep (from culture) or PCR product
  by measuring mutations at specific marker regions
  e.g. restriction sites.
• Methods include REA RAPDs DGGE, VNTRs.
• 3. Sequencing - reading the actual DNA sequence
  of a gene.

23
REA (restriction enzyme analysis)

• DNA is digested with restriction enzymes
• Restriction digest is run out on an agarose gel.
• Restriction patterns are identified.
• Can identify REA types by sequencing or just make
  measure of diversity by numbers of patterns
• If two organisms have different restriction
  enzyme patterns there is at least 1 difference in
  DNA sequence between them.