Abbo Metallothionein

1
DETECTION OF HUMAN METALLOTHIONEIN 1-A
GENEMUTATIONS AMONG INFORMAL GOLD MINING
WORKERSAT ABU HAMAD, SUDAN USING POLYMERASE
CHAINREACTIONRESTRICTION FRAGMENT
LENGTHPOLYMORPHISM

• By
• Mohammed Elnour Ahmmed Abbo.
• B.V.Sc University of Nyala, 2010
• Supervisor
• Dr. Sumaia Mohamed Ahmed Abukashawa.

2
Introduction
What is Metallothioneins Structure and its
biological functions? Intracellular, low
molecular and cysteine-rich proteins with
molecular weight from 6 to 7 kDa MTs consist of
two binding domains a and ß. N-terminal part of
protein ß-domain three binding places for
divalent ions. C-terminal part of protein
?-domain four binding places for divalent
ions. The most repeated structure motif
cysteine(C)ycysteine(C)-x- cysteine(C).
(C cysteine, S serine, K lysine, G
glycine, A alanine, T threonine, N
asparagine,E glutamic acid, M methionine, P
proline,D aspartic acid, Q glutamine, I
isoleucine)
Content of aminoacids
Figure 2 Structure of Metallothioneins.
Figure 1 Metallothioneins Amino acids contents.
(1)
3
Gene expression and Biological functions of
Metallothioneins
1.Cell Proliferation and Apoptosis. 2.Metallothion
eins as scavengers of reactive oxygen species.
3. Homeostasis of Essential Metals. 4.Detoxificat
ion of heavy metals.

1. Entering of metal ions into a cell.
2. The ions interact with metal synthesis inhibitor
   (MTI).
3. Released metal transcription factor 1 (MTF-1)
   binds to metal responsive element (MRE).
4. Synthesis of mRNA to translate MT.
5. MT binds a heavy metal ion, the
   MTheavy-metal-ion complex is transported to
   kidney or (f) to heavy metal dependent regulation
   proteins.

Figure 3 Metallothioneins biological function .
(2)
4
Objectives

• The objective of this study is to test the
  hypothesis by
• (1) Design a study to investigate to what extent
  do effect of human Metallothionein 1 A gene
  polymorphism in (HgHydra gyrium.) Liquid mercury
  exposure toxicity for gold miners in Abu Hamad
  Sudan, and Khartoum grouped in metallic mercury
  amalgamation and smelting workers.
• (2) Look for new genetic variations in MT1A Gene
  by use of restriction fragment length
  polymorphism as one method used molecular biology
  laboratory applications.

Figure 4 Map of Sudan shown () Abu Hamad area
of study.
(3)
5
Materials and Methods

• Ethical Clearance Ethical review and consent
  approval were obtained from the Ethical Review
  Committee of the Faculty of Science, University
  of Khartoum (Khartoum-Sudan),Subjects were chosen
  based on their exposure to elemental mercury in
  civilian artisanal gold mining in Altawaheen area
  in River Nile State. History of the subjects
  medical tests was obtained from Abu Hamad
  hospital in River Nile State.
• Primary Data The study utilized quantitative
  methods
• for data collection, a detailed questionnaire.
  
• Secondary Data included related activities
  information .

Occupation No. Age average (year)
Gold mining workers 30 29.33
Non-gold mining workers 25 28.16
Total 55 57.49
Figure(7) Subjects age Distribution and average.
Clinical signs No. ()
Urinary tract (nephritis) 8 (26.6)
Pulmonary diseases 6 (20)
Neurological (muscle Tremors) 4 (13.3)
Figure(6) Age distribution for case subjects.
Figure(8) Clinical signs for case subjects.
(4)
6

Methods of Data Collection
Figure 9 Mercury amalgamation process in water
dips by workers using naked hands and fingers .
Figure 10 Two Workers in field .
(5)
7

• Methods of Molecular Investigation
• Selection and design of primers for
  metallothionein gene used domain
  www.primer3plus.com to amplify the MT-1A gene
  coding region based on PubMed database.
• Foreword 5? - CTCCCCAGAACCACACACTT - 3?
  Reverse 5?- CCCAGCAACTGATTCAGGAT - 3? BLAST on
  web domain www.ncbi.nlhm.nih.gov shown in figure
  (11)

Figure 11 NCBI Basic Linear Alignment Search
Tool result for submitted Foreword and Reverse
primers.
(6)
8

Results
(A)
(B)
Figure 12 (A) 2 Agarose gel stained with
EtBr showing MT-1-A gene PCR product size162
bp in lanes 2 and 3. Lane M showing
DNA molecular marker (1000-100 bp) .
Figure 13 (B) 3 agarose gel stained with
EtBr for PCR product of MT1A polymorphism
after digestion with Hinf1 enzyme lanes
1,2,10show (148 bp) homozygous, lanes 3,4,5,6
show heterozygote (113 bp) , lane 9 is
negative control, lane M showing DNA marker
(700-50 bp) .
(7)
9

Distribution of the mutation in study subjects
and control group are shown in figures (14) and
(15). Gold mining workers available for analysis
were 10 heterozygous 33.3 and 20 homozygous
66.6 for the mutation. The gold mining workers
showed new mutation not detected in the control
subjects. The genotype and allele distribution
among gold mining workers could not be detected
because of this new mutation in the gene.
Figure 14 case subjects.
Figure 15 study subjects.
(8)
10

Discussions

• Discussion of Results from the Questionnaire
• There is an affect of elemental mercury
  exposure associated with nephrotoxicity as
  detected in the studied informal gold mining
  workers following exposures to elemental mercury.
  This is in accordance with previous reported
  studies of Tsuji et al., (2003). Absence of
  medical tests for urine and hair mercury levels
  in hospitals could not allow the correlation with
  urinary levels of Hg in workers.
• Discussion of Molecular Results
• The hypothesis is tested by DNA genotyping of
  informal gold mining workers.
• New mutations in MT1A sequence GAATC (G
  alteration), cleaved with HinfI, in this study
  was detected this demonstrates that gene
  mutations may affect subjects by showing various
  clinical signs including nephritis, pulmonary
  diseases and muscle tremors associated with
  elemental mercury exposure.
• This study is the first attempt in Sudan of a
  group of informal mining workers population that
  investigated an association between elemental
  mercury and MT1A polymorphism however the sample
  size (55 subjects) challenged the study findings
  for wild type homozygotes in addition to the
  absence of medical tests for urine and hair
  mercury levels in hospitals.

(9)
11
Conclusions

• From findings of this study it is suggested that
  some MT genetic polymorphisms may affect
  elemental mercury exposure.
• Recommendations
• It is recommended that the Federal Ministry of
  Health starts mission teams for gold mining areas
  for routine tests for mercury urine and blood
  levels.
• Ministry of environment should be making campaign
  in the areas of gold mining to evaluate hazards
  caused by mercury use.
• Open new research gate for Metallothioneins genes
  in Sudanese population (Metallomics)and MTs
  Biomarkers, in addition to Increasing
  socio-economic studies and Participation for
  UNIDO ,Global Mercury Project GMP needs to be
  applied.
• Chelating therapy should be available by meso-2,
  3-dimercaptosuccinic acid (DMSA). 2,
  3-dimercaptopropane-1-sulfonic acid (DMPS).
• Introduced of an alternative gold extraction
  technology could assist the workers.
• Dissemination of information for toxicity effects
  of mercury should be done through media press,
  radio, television, posters, Education levels
  Authorities, community leaders,NGOs .

(10)
12

Acknowledgements

• My extended thanks to Dr. Mai Abdel Rahman
  Alamasri for her enormous support for this
  research work, she has been very helpful and kind
  with my requests in laboratory related
  activities, without her my research could have
  never been accomplished. Special thanks are due
  to Dr. Hind Mohamed Abu Shama for her efforts in
  bioinformatics courses.
• I would like to thank all the team working with
  at the Genetics Laboratory in the Department of
  Zoology, Faculty of Science, University of
  Khartoum Mrs Ihsan Taj Alsir, Ms. Amal Gafar
  Thanks are extended to Mrs Mawda Taj alsir in
  Abu Hamad Hospital.Thanks are also for volunteer
  individuals in the Gold mining and extraction,
  with special thanks to Mr. Zachariah.I thank all
  those who helped me during this research and
  preparation of the Dissertation, I appreciate
  their tremendous help and encouragement towards
  completing this research.

I am grateful my supervisor Dr. Sumaia Mohamed
Ahmed Abukashawa who provided me great guidance
and much needed steps in my research path.
13