Conservation Genetics

1
Conservation Genetics
6080 Fall 2009
2
We will talk about genetics from two
perspectives. First, we will talk about how
genetics influences the viability of populations,
both now and in the sense of adaptation to future
change. Second, we will talk about how genetic
tools provide new insight into conservation
problems and what new conservation policy may
arise.
3
What to count?

• Nc number of individuals
• Or
• Ne genetically effective population

4
From a genetics perspective
Know WHAT to count..genetic effective population
size Ne

• Populations are smaller than they seem
• Genetic diversity is lost as Ne declines, not
  just Nc
• Ne reduced by many things, e.g., unequal sex
  ratio, mating structure, population
  fragmentation, age-related disease (Ebola), etc.
  etc.

5
Genetically effective population

• The genetically effective population (N with
  subscript e,  Ne) is the number of individuals in
  a population that contribute genes to the next
  generation.
• It is usually less, and often much less, than
  the census population (Nc).

6

• It is influenced by age structure, sex ratio,
  social structure, and especially by spatial
  structure. Metapopulation structure may enhance
  population viability but it may also contribute
  to loss of genetic variation by reducing Ne.
  Genetic models typically use Ne rather than Nc.
• Loss in heterozygosity depends on Ne not Nc

7
First, a conservation crisis and a genetics enigma
8
All the remaining individuals of the Great and
Lesser Apes would fit into a couple of football
stadiums (IUCN Red Book 2007) Ebola virus in
Africa (made worse by war, habitat loss (logging
and oil palm), bushmeat, poaching, etc.) Ne ?????
9
The enigma of viruses

• Cause of many diseases that threaten species
  (plants and animals).
• Total number of viral types is huge.
• Viruses, especially single strand RNA viruses,
  have very high mutation rates.
• Viruses are obviously successful yet many have as
  few as five genes. Ebola has only 15 genes.

10
Viral enigma

• With high mutation rates and few genes how do
  they adapt to host immune defenses????

11
ANDeffects of genetic change on ecosystems
12
A species pool of genetic diversity exists at
three fundamental levels
13
What can you learn about populations from
measuring levels of heterozygosity?First, you
have to know what is normal or average for the
taxon.
14
(No Transcript)
15
Among population genetic diversity (Dpt) What
can it tell you? Above average for taxon
Unusual spatial segregation low mobility high
site fidelity (Red Cockaded Woodpeckers, Howler
monkeys) farther from ideal breeding
population Nc much Higher than Ne Below average
for taxon Unusual high migration panmixis
closer to ideal breeding population Nc close to
Ne
16
Heterozygosity

• Some genetically identical populations do well
  (Northern Elephant Seal) others not
• (Cheetahs)
• Rate of decline in heterozygosity
• is extremely important

17
Evolutionary Change
Genetic drift
Mutation
Most mutations are recessive. Here the mutation
is dominant
Migration/gene flow
Natural selection
18
Hairy-Nosed Wombat. Is 65 enough to survive?
What can genetics tell us?
If these populations can increase, are these
numbers good insurance against extinction? Must
also consider genetic variation.
1000 Kemps Ridley Turtle?
300 Right Whales?
19
Population bottlenecks and reduced genetic
variation
Genes lost through drift
Slower recovery of genetic variation
More homozygosity
20

..
Lost uncommon black allele
21
Rare alleles more likely lost in small
populations (genetic drift)
22
Galapagos tortoise population on Volcan alcedo
suffered severe bottleneck about time of massive
eruption (molecular clock and geological
evidence). Population has less genetic variation
than other populations but population has
recovered.
23
American bison, a bottleneck enigma? At time of
European contact, bison estimate was about
60,000,000 By 1890 it was about 750 By 2000 the
number was about 360,000 Bison have considerable
genetic variation (within and between population
heterozygosity). How did they retain so much
genetic variation??? Hint geographic herds and
buffalo parks.
24
Some, but not all, inbred populations have lower
fitness due to expression of deleterious genes
25
Deleterious genes are usually recessive. So in
more homozygous inbred populations they are more
likely to occur at the same locus.
26
Inbred white-footed mice (open circles) had lower
survivorship than outbred individuals (solid
circles) after release into the wild
27
(No Transcript)
28
Inbreeding depression Vulnerable small populations
Population of 40 European Adders was isolated by
road. In a few years malformed individuals and
lower birth rates began to cause population
decline. This is an example of inbreeding
depression. Population growth was restored when
individuals from different population were
introduced.
29
Not all alleles are equal

• MHC (major histocompatibility complex) genes
  enhance immune response. Located on chromosome 6
  in humans.
• Heterozygous MHC generates more types of immune
  molecules and therefore is more adaptive to
  counter diverse pathogens.

30
Intracellular diversity of MHC is important

• MHC codes for large proteins that transport viral
  particles to surface and holds them for T-cells
  (killer cells)
• Viral diversity is best delt with by diversity of
  MHC proteins
• Trade-off is that large proteins are costly to
  make. Therefore..?

31
African Cheetahs, wild and in zoos, are highly
inbred with little genetic variation. A feline
viral disease swept through European zoos killing
many cheetahs. Lions have much greater genetic
variation and were relatively unaffected by the
disease.
32
How some plants avoid inbreeding
Programmed cell death an auto-immune response
of style (obligate outcrossing). Timing of
stigma and style reception differ Male and
female flowers on different plants Foreign
pollen out-competes self pollen (common)
33
Many domesticated plants and animals, especially
pets, are highly inbred
34
and some people. Why states outlaw marriage
between close relatives.
35
Charles II of Spain illustrates the Hapsburg lip,
an Inbred trait in this royal line.
36
Severe effects of inbreeding in zoo tiger
37
Bottleneck consequences

• More deleterious genes expressed by more
  homozygosity means very slow recovery or
  extinction
• (African Cheetah)
• Fewer deleterious genes means fast recovery (N.
  Elephant Seal)
• Recovery from bottleneck may reduce future
  inbreeding effects.
• Founder effect from migrants from small population

38
Genetics as a tool for conservation management
39
Genetics provides new insight

• Pacific Gray Whales thought to be recovery
  success at 22,000 current Nc
• But, 10 whales are undernourished
• Calving frequency is down
• Feeding behavior has shifted from bottom
  plowing (which supports sea birds) to feeding in
  water column

40
Pacific Gray Whale Using Genetics to Infer the
Past
41
Gray whales migrate from winter feeding area to
southern mating and breeding site. Longest mammal
migration.
42
(No Transcript)
43
Pit marks left by whale foraging. Currently
re-suspend about 172 million tons each year. More
than 2X that produced by the Yukon River, the 3rd
largest US river. Nutrients support fish and food
for sea birds.
44
Recovery to 22,000. A success story?
45
Gray whale cont

• Genetic variation between individuals indicates
  much larger population in past
• (mismatch analysis of sequence frequencies)
• Accounts from 1700s indicates large whale
  populations. Their fetid breath fouled Monterey
  Bay.. Calif. Bishop

46
Gray whale cont

• Decline in plankton, plankton-feeding fish and
  the birds that eat those fish suggests a decline
  in productivity
• Probably related to global warming and
  temperature increase in coastal waters
• Thus, Gray Whales may not be at historic carrying
  capacity but rather the environment is changing
  to their detriment.

47
Gray whale cont

• Genetic information suggests an early population
  between 78,500-117,000
• These populations would have disturbed between
  22-31 of the sea sediment each year
• and the effect from this nutrient input on birds
  and fish??

48
Grizzly bears what genetic tools can tell us

• The size of the population
• The sex ratio
• Migration
• Done through the use of microsatellite markers.

49
Note DNA alphabet has only four letters
A,C,T,G and these can only pair AT, CG
50
Microsatellite is a repetitive sequence of 1-6
base pairs on single strand of DNA
Individual one Two microsatellites. 7AC and 3ACT
ACTAGACACACACACACACTAGCGACCTACTACTACTAG
Individual two Two microsatellites. 6AC and 3ACT
ACTAGACACACACACACTAGCGACCTACTACTACTAG
In practice, many microsatellites are needed to
create individual genetic fingerprints, i.e. to
identify individuals. But fewer needed to
identify species or geographic populations.
51
Grizzly bear range in lower 48 states
52
(No Transcript)
53

• Heterozygosity loss in 100 grizzly bears

Exchange 2 unrelated bears every 10 years in 100
Nc bears Isolated 100 Nc bears
54
Genetic markers to determine origins of protected
populations

• DNA amplified from fecal and tissue samples
• Used to construct DNA library to determine origin
  of elephant ivory, etc.

55
(No Transcript)
56
Genetics and dams. Populations of Oncorhynchus
mykiss usually contain two forms, a freshwater
form called Rainbow Trout and a form the lives
mostly in the sea, returning to freshwater to
spawn, Steelhead Trout. Putting a Steelhead
ladder around a dam in California allowed
Steelheads to mate with Rainbows, thereby
increasing genetic diversity.
57
Genetics can help make conservation
decisions. Which river basin should be
preserved? Each has four imperiled fish species.
58
A genetic analysis shows that fish in river basin
C have fewer genes in common (or morphological
characters are very different). Protecting river
basin C would protect the greatest genetic
diversity. But, may be other considerations in
choosing the river basin
59
Genetics and captive breeding. May select for
individuals that are adapted to the captive
environment but not to the wild environment,
e.g., may not recognize predators. Difficult to
avoid.
60
Wildlife as possible vectors of antibiotic
resistance genes?
Canada geese in Chesapeake Bay carried E. coli
resistant to penicillin G, ampicillin,
cephalothin, and sulfathiazole and enterococci
resistant to cephalothin, streptomycin, and
sulfathiazole.
61
Better insight into conservation problems by
combining genetic with non-genetic tools
62
(No Transcript)
63
Swainson Thrush..A neotropical migrant.
Declining in some parts of its U.S. breeding
range but not in others. Why?
64
Swainson Thrush breeds in northern North America
from northern California and Great Lakes into
Canada and Alaska. During the non-breeding
season it is somewhere in the southern US or
down into Latin America as far as Argentina.
65
Combining genetic with other methods For
migratory birds, how can we associate breeding
sites with non-breeding sites? For Swainson
thrush breeding in Wisconsin, where did they
spend their non-breeding time?
66
Suppose the Wisconsin population began declining
and you want to know what is happening to the
thrushs habitat on its non-breeding habitat.
Where would you begin to look? If you banded
100 birds in Wisconsin, what would be the
probability of recovering them somewhere between
Georgia and Argentina???
67
Genetics Mitochondrial DNA (mtDNA) is
extranuclear and therefore inherited maternally.
Chloroplast DNA in plants is similar. mtDNA is
not reorganized during recombination and remains
stable within maternal lines, except for
mutations.
68
mtDNA is haploid. Segments of DNA can be
separated by restriction enzymes and sequenced
for their gene array. Segments (microsatellites)
that are associated with specific geographic
areas are called haplotypes. For the thrush,
there are tropical coastal haplotypes and
interior haplotypes. Very small amounts of blood
can be taken from feathers and the DNA amplified
by PCA for analysis by sequencing.
69
coupled with non-genetic method Stable
isotopes Non-radioactive elements with more than
the normal number of neutrons. Most stable
isotopes have one or two extra neutrons and are
therefore very slightly heavier, e.g.,
Carbon-12/13, Nitrogen-14/15, Oxygen-16/18,
Deuterium -1/2, and Sulfur-32/34
70
Hydrogen H/D strong North-South gradient in
ratio in precipitation Sulfur marine sulfur is
enriched with heavy sulfur isotope Therefore
H/D isotopes in feathers record the latitude of
molt S/S isotopes in feathers tell if individual
was from a coastal population
71
Pre-molting feathers were sampled for
isotope ratios and mtDNA to provide evidence of
where the female was when the feathers were
formed the previous year. Non-invasive. Birds
were banded.
72
Results By combining both isotope and mtDNA
analysis, 75 of the birds could be assigned to
their correct breeding and non-breeding
sites. Reference Kelly et al. 2005. Combining
isotopic and genetic markers to identify
breeding origins of migrant birds. Ecol. Appl.
15 1487-1494. POLICY IMPLICATIONS ???
73
Genes and Ecosystems
74
Cottonwood trees (Populus spp.) Occurs along
streams Several species hybridize
75
Cottonwood genotypes with high tannin conc
Cottonwood beavers
Fewer insects and less endophytic fungi


and
Fewer birds