Introduction to UNIX/Commandline/PERL

1
Computing Concepts for Bioinformatics

• More about UNIX filenames
• Introduction to EMBOSS
• EMBOSS input/output
• Editing Files
• The Programming Process
• PERL concepts
• Your first PERL program

http//amadeus.biosci.arizona.edu/nirav
2
Your new amadeus prompt!

• To make navigation easier we have modified your
  prompt from
• To
• Now you can see the directory you are in the
  symbol is your home directory
• Since I did a cd to bos-db now my prompt shows
  bos-db at the end (earlier it was )

3
More About UNIX Filenames

• Many filenames include an extension
• e.g. run_me.pl, my_seq.tfa, well.whatever
• Filenames and extensions should reflect the
  contents and format of the file
• When typing a filename use the tab key for
  automatic filename completion
• i.e cd prltTABgt should fill in the rest
• If it does not ..provide few more characters
  (you may have 2 directories starting with pr)

4
Wildcards and Filtering

• The wildcard matches anything!
• e.g. to see all files with names that begin with
  t, type ls l t
• For files that end with t, type ls l t
• Be very careful with this wildcard!
• When using File Selection Boxes, using wildcards
  and Filter can cut down the list of names that
  appear
• Well see this in the Notepad Editor

5
UNIX permissions (or modes)

• ls l shows file types, permissions, ownership,
  size, date/time last modified
• 3 groups of permissions u g o
• 3 types of permissions r w x
• To remove read permissions
• chmod r secret_file
• To make a PERL script executable
• chmod x my_script.pl
• (otherwise it wont run!)

6
EMBOSS

• www.emboss.org
• European Molecular Biology Open Software Suite
• Free Open Source software analysis package
  specially developed for the needs of the
  molecular biology community
• Provides a comprehensive set of sequence analysis
  programs (approximately 100)

7
EMBOSS (programs)

• Integrates other publicly available packages
• Can be accessed through BioPERL modules(easy
  automation)
• Sequence alignment
• Rapid database searching with sequence patterns
• Protein motif identification, including domain
  analysis
• Nucleotide sequence pattern analysis, for example
  to identify CpG islands or repeats.
• Codon usage analysis for small genomes
• Rapid identification of sequence patterns in
  large scale sequence sets.
• Database creation/indexing

8
Interacting with EMBOSS

• EMBOSS programs are run by typing them at the
  UNIX prompt (in your Xterminal) with or without
  parameters/options
• EMBOSS command syntax follows normal UNIX command
  conventions
• It will prompt you for parameters not provided
  when invoking the program
• In doubt useprogram_name -help (seqret
  help)tfm program_name ( tfm seqret )
• Use wossname to search a program by keyword

9
Sequence Formats

• Sequence Formats
• FASTA
• GenBank
• EMBL
• SwissProt
• PIR
• FASTA formatgtSeq_Name description and some
  other comment ttcctctttctcgactccatcttcgcggtagctggg
  accgccgttcagtcgccaatatgcagctctttgtcgcgcccaggagctac
  acac
• IDs and Accessions
• ID was human readable and name suggested
  functions etc,
• Accession number are database assigned (now a
  days they are same as ID )
• ID 'hsfau' is the 'Homo Sapiens FAU pseudogene
  Its accession X65923 (sometimes Accession.1
  for version)
• Multiple sequences per file
• No connection between file name and ID
• GFF (standard sequence feature exchange)

10
EMBOSS USA

• USA (Uniform Sequence Address)
• "formatfile"
• "formatfileentry"
• "dbnameentry" (we dont have this configured)
• "_at_listfile" (a file of file-names ls .seq gt
  mylist )
• Format is not required when reading in a
  sequence, EMBOSS will guess the sequence format
  by trying all known formats until one succeeds
• When writing out a sequence, EMBOSS will use
  fasta format by default. You can specify another
  format to usegcgmyresults.seqemblmyresults.o
  ut

11
Setting up your Editor (Nedit)

• www.nedit.org
• Set your preferences (syntax highlight, line
  number)
• Save default
• Exit
• Restart
• You can also use the terminal to open a file or
  create a new oneusing nedit e.g.nedit test.pl
  
• The pushes the job in the background giving
  your prompt back (so you can do multiple tasks)
• You can type fg to get it back and control-z
  followed by bg to push it back (and get your
  prompt)

12
Nedit (File dialog box)

• Ignore everything with .
• Double click on directoryor select with mouse
  and use enter key
• What is . and .. ?
• Use filter if you have manyfiles ( .pl )
• Select the file to edit/open with mouse (should
  have black background) then click on OK
• Save (Control-s) and Save As

13
Programming Process

• When asked to develop...look around before you
  re-invent the wheel
• Requirements Analysis What input, output,
  formats, source of data, frequency of update
  (general solutions are better than specific)
• Design Phase (how and what to use)
• Flow charts for (logic and data) UML, use cases
  http//www.uml.org/
• Pseudocodeget filename open file and read
  sequences For each sequence If length is
  greater then 100Kb print error msg

14
Programming

• After the design phase
• Always comment your code!!
• Use version control filename.1 etc for small
  projectCVS http//www.cvshome.org/
• Code has to be human readable but machine
  parseable !
• Test and debug code using different scenarios for
  input
• Dont feel shy to use paper and pencil ..its
  easier at times
• http//www.eecs.wsu.edu/c/programm.htm

15
Introduction to PERL

• Invoking PERL
• PERL statement syntax non-loop lines end with
• (You will forget this many times!!)
• Basic Input/Output
• STDIN, STDOUT, print and writing to files,
  sockets
• Variables Scalar Data
• Numbers 12, 12e5, -12.534
• Strings who likes Austin Powers?
• Operators , -, lt, gt
• Flow Control
• if, while, for, foreach
• Arrays

16
URLs for Learning PERL

• Perl in 10 minutes
• http//www.geocities.com/SiliconValley/7331/ten_pe
  rl.html
• Learning Perl
• http//educationplanet.com/search/Computers_and_th
  e_Internet/Computers/Programming_Languages/Perl/
• http//cslibrary.stanford.edu/108/EssentialPerl.pd
  f
• Perl for Biologists
• http//www.uni-hohenheim.de/rebhan/perl/

17
Invoking Perl

• First line of a perl program
• ! /usr/local/bin/perl -w
• by itself means comments, i.e. the line is not
  interpreted.
• It is important to comment your code!!!
• !/usr/local/bin/perl
• Program by Baha Men (Nov10,2000)
• print Who let the dogs out\?n
• The above line outputs to screen
• the (only) famous song by the group

18
Variables

• Variable is something that will store values
  while your program is running
• You can set initial values of variables and
  modify these values as the program executes.
• No need to pre define
• Automatically get global scope
• You can store numbers, text in the variables
• a 1
• z a 3.1412653505
• b I put the cat out
• gene_name C127899.1

Note the for text
19
Arithmetic Operators

• a 1 2 Add 1 and 2 and store in a
• a 3 - 4 Subtract 4 from 3 and store in
  a
• a 5 6 Multiply 5 and 6
• a 7 / 8 Divide 7 by 8 to give 0.875
• a 9 10 Nine to the power of 10
• a 5 2 Remainder of 5 divided by 2
• a Increment a by 1
• a-- Decrement a by 1
• if (a lt 2) Lesser than or equal

20
String Operator

• b Hello c World
• a b . c Concatenate b and c
• print a This is HelloWorld
• We can do the same using
• print a b from me\n This will print
  Hello World from me
• Followed by a newline
• Difference between and covered later
• \n is newline this puts space between 2 lines
• \t is the tab operator i.e Hello World

21
Testing Values

• a b Is a numerically equal to b ?
• Beware Don't use the
  operator.
• a ! b Is a numerically not equal to b?
• a eq b Is a string-equal to b?
• a ne b Is a string not equal to b?
• Use for numbers and eq for strings

22
Flow Control

• for (initialize test increment)
• first_action
• second_action
• etc
• while (condition)
• first_action
• second_action
• etc
• if (condition)
• first_action
• second_action

for( count 0 count lt 10 count)
print Count is count \n
while (president ne Nader) print Try
again\n Ask again president ltSTDINgt
Get input chomp president Chop off
newline
23
Arrays

• Array variable is a list of scalars (ie numbers
  and/or strings).
• Same format as scalar except that they have a _at_
  i.e _at_names is a array while names is scalar
• _at_names (Al,George,Ralph)_at_party
  (Democrat,Republican,Green)
• Array data can be referenced by using the index
  number which starts from 0 names0 is Al and
  party1 is Republican
• You can set values using names3Pat

24
I get the picture ..just get on with it !

• Your first program hello.pl
• Create directory prog1 and save files there
• Print hello world (Thats too easy)
• Ask the user for a name
• Greet the user
• Ask the user for password
• If it matches the password yahoo then greet else
  boot
• You can type perl hello.plor chmod ux hello.pl
  and run it./hello.pl (remember to cd prog1)

25
Your first PERL script

• !/usr/local/bin/perl First line must be
  path to PERL interpreter!! Prompt the user to
  type and hit enterprint Please enter your name
  read from Keyboard and remove new line
• name ltSTDINgtchomp(name)print Hello
  name please give me secret passwordpassword
  ltSTDINgt Now compare it to hidden
  passwordif(password eq yahoo ) print
  Welcome my buddy name\nelse print Bite
  Me password is invalid\n