Title: Development of Microsatellite Markers in Bioenergy Crops, Switchgrass
1Development of Microsatellite Markers in
Bioenergy Crops, Switchgrass Hybrid Poplar
Shreni Keniya Knox College, IL Lee
Gunter Environmental Sciences Division ORNL
2 A Few Predictions.
- Oil and natural gas reserves will deplete in a
few decades - Fossil fuels will last just another 200 years
3The Solution
- BIOENERGY Fuel Sources
- SWITCHGRASS
- (Panicum virgatum L.)
- HYBRID POPLAR
- (Populus spp. Salix spp.)
4Bioenergy Feedstock Development Program (BFDP)
- Sponsored by U.S. DOE
- To improve biomass feedstock quality quantity
by traditional breeding methods
5But Recently
- DNA and Protein Markers have become popular
- Alloenzymes/Isoenzymes
- RAPDs
- RFLPs
- SSRs
6Microsatellites or SSRs
- Short tandem repeats of simple or complex di-,
tri-, tetra nucleotides - Usually found in unique DNA sequences
- Used for linkage analysis in locating genes
- Useful in determining quantitative trait loci
(QTL)
7The Objective Is
- To test novel primers in
- 3 parental populations in switchgrass
- 3 Populus spp. 4 Salix spp.
8Species
DNA Extraction
Sequencing and primer design
atggctatcgtatcgattttgctatgcgagcggttaaaatctatgttggg
atatggtatttgaatctcgtatcgctgtatcgctgatgcgcgcgcgcgcg
cgcgcgcgcgcttatctgctatcgttsagctatcgttcgggttaggttta
tatgtagtctcgtcgctcatagttagctggttatcttatcgtctcgatct
Clone
Genotype analysis of fluorescent PCR
PCR
Gel Electrophoresis
Analysis of marker polymorphism
9 Gel Electrophoresis
10Switchgrass genome
11SSR Analysis In Switchgrass
12 SSR Analysis In Populus
13SSR Analysis in Willow
14The Bigger Picture
- A genetic map can help estimate
- how many genes control a trait,
- where the genes are located
- how much affect does each gene have on a trait
- if individual genes have any effect on more than
one trait - if they function similarly in different
environments and - if the effect of one gene influence the effect(s)
of others
15Acknowledgements
- Research was funded by the Department of Energy's
Office of Fuels Development (OFD) through the
Bioenergy Feedstock Development Program at ORNL.
Research participation sponsored by the HERE/GLCA
program at ORISE. - We would like to thank
- Zamin Yang of ESD for cloning and sequencing
work, and for her help with fluorescent
genotyping - Ken Vogel, USDA-ARS, Lincoln, NE for providing
plant material for 'Kanlow' parent VK15 and
'Summer' parent VS16 and - Ali Missaoui, Department of Crop and Soil
Science at the University of Georgia for
providing genomic DNA from 'Alamo' P13 and P19.