DNA alphabet

1
DNA alphabet

• DNA is the principal constituent of the genome.
  It may be regarded as a complex set of
  instructions for creating an organism.
• Four different bases (nucleic acid
  bases/nucleotides) appear in DNA adenine (A),
  guanine (G), cytosine (C), thymine (T)
• Rule for basepairs (bp) A ?? T, T ?? A ,
• G ?? C, C ?? G (four bp configuration). Each
  comprises a single piece of information in the
  DNA molecule (for the creation of amino acid)

2
DNA double helix

• The DNA molecule can be reconstructed from just
  one of the 2 strands.

3
CODONS

• The basic unit of the genetic code is the DNA bp.
  The human gene can range in size from thousands
  to hundreds of thousands of bps.
• Human DNA comprises of approximately 3 billion
  bps (Human Genome Project effort to decode all
  of the 3 billion nucleotide base pairs)
• Three DNA bps combine to form a codon which codes
  for the production of an amino acid (low-level
  instruction), for example, AGA represents A ??T,
  G ??C, A ??T.
• Sequences of codons code for the assembly of
  amino acids into RNA, polypeptides, proteins, or
  functional RNA.
• The products so formed mediate the growth and
  development of the organism.

4
DNA SEQUENCE

• A DNA sequence is a succession of letters
  representing the structure of a DNA molecule or
  strand. The possible letters are A, C, G, and T,
  representing the four nucleotide subunits of a
  DNA strand (adenine, cytosine, guanine, thymine),
  and typically these are printed abutting one
  another without gaps, as in the sequence
  AAAGTCTGAC. This coded sequence is sometimes
  referred to as genetic information. A succession
  of any number of nucleotides greater than four is
  liable to be called a sequence.
• In genetics terminology, DNA sequencing is the
  process of determining the nucleotide order of a
  given DNA fragment.
• The sequence of DNA encodes the necessary
  information for living things to survive and
  reproduce. Determining the sequence is therefore
  useful in 'pure' research into why and how
  organisms live, as well as in applied subjects.

5
String Searching Algorithms

• A string of nucleotides is called DNA or RNA.
• String searching algorithms try to find a place
  where one or several strings are found within a
  larger string.
• Naïve string search The simplest and least
  efficient way to see where one string occurs
  inside another is to check each place it could
  be, one by one, to see if it's there. So, first
  we see if there's a copy of the substring in the
  first few characters of the text if not, we look
  to see if there's a copy starting at the second
  character of the text if not, we look starting
  at the third character, and so forth.

6
DNA Sequence alignment

• Sequence alignment is an arrangement of two or
  more sequences, highlighting their similarity.
  The sequences are padded with gaps (usually
  denoted by dashes) so that wherever possible,
  columns contain identical or similar characters
  from the sequences involved
• Example
• tcctctgcctctgccatcat- -
  -caaccccaaagt
• 
  
• tcctgtgcatctgcaatcatgggca
  accccaaagt
• It is usually used to study the evolution of the
  DNA sequences from a common ancestor. Mismatches
  in the alignment correspond to mutations, and
  gaps correspond to insertions or deletions.
• The term sequence alignment may also refer to the
  process of constructing such alignment or finding
  significant alignments in a database of
  potentially unrelated sequences.

7
BIOINFORMATICS

• Bioinformatics was born of the need for
  high-powered computing ability to help organize,
  analyze, and store biological information
  primarily DNA and protein sequence data.
• Gene sequence databases in the United States is
  called GenBank administered by National Center
  for Biotechnology Information.
• Besides storing biological information, the
  database can be used to help analyze genes, their
  functions, and evolution.
• A DNA that has been cloned and sequenced is
  entered in a search computer program called BLAST
  to determine if
• 1) it has already been cloned
• 2) it is related to an already known gene (if it
  is a new gene sequence, its relatedness to other
  known sequences might help determine its
  biological function)
• The BLAST program lines up the query sequence
  with each sequence in the database in an
  alignment and shows similar nucleotides by
  connecting them with a line. This gives an
  estimate of gene relatedness.