Kazusa DNA app note PowerPoint PPT Presentation

presentation player overlay
1 / 11
About This Presentation
Transcript and Presenter's Notes

Title: Kazusa DNA app note


1
Background
HUGE update 2003
Since 1994 we have been isolated and entirely
sequenced long human cDNA clones and have already
registered to the public database more than 2000
genes (KIAA genes) to date.
KIAA0001- KIAA2029
What are large cDNAs? Not extensively explored
yet, but they are NOT minor species in
mammals Technically difficult to
analyze Capable of encoding large proteins What
are large Proteins? Functionally characteristic
(Sizes more than 100kDa) Positionally cloned
gene products are frequently large
proteins Frequently located at the node of
protein interaction network
http//www.kazusa.or.jp/huge
2
Mouse KIAA cDNA Project in KDRI
Kazusa DNA Res. Inst.
From December 2001, we initiated a new project
supported by JST (Japan Science and Technology
Corporation) to identify the functions of KIAA
proteins. However, there are obvious limitations
in analysis of human genes primary due to ethical
issues. We therefore decided to use an animal
model for accumulation of the functional
characterizations. For this purpose, we firstly
started to isolate and determine entire sequences
of mouse cDNA clones which encode the
polypeptides corresponding to human KIAA proteins
(mKIAA), and subsequently to generate antibodies
against mKIAA proteins.
3
ROUGE (Rodent Unidentified Gene-Encoded protein
database)
ROUGE provides you all the information you need
!
Mutual links with other databases
InterPro PSORT SOSUI OMIM
http//www.kazusa.or.jp/rouge
4
Annotation of mouse KIAA genes
ROUGE database
Nucleotide sequence of cDNA
Integrity check of Protein coding
region (GenMark analysis)
cDNA mapping along the genome
Homology search
Integrity check of 3 end of cDNA
Protein domain search
Length of 3UTR 720 bp Genome contig ID
Chr1_17 PolyA signal sequence ---------------
------------- (AATAAA,-20)
TGTGTTGTACTTTGAAATAAATGA TGCTTTTTTTC
Structural comparison between mouse human
HUGE database
Disease relevance and Protein localization
OMIM database search Transmembrane prediction
(SOSUI) Protein localization site
prediction (PSORT2)
Expression profiling
5
  • Strategy to generate mKIAA antibodies
  • Selection of appropriate shotgun clones for
    antigen.
  • For this purpose, we visualized the information
    of each shotgun clone.
  • 2. Transfer the shotgun fragment into expression
    vector by in vitro recombination method.
  • 3. Transformation of E.coli Rosetta (pLysS) cells
    and check expression.
  • 4. Check solubility.
  • Preculture 300 ml
  • IPTG induction (dilute in 10 vol. of CM 0.1mM
    IPTG 1.5h 25?)
  • Extraction with CelLytic B II (SIGMA)
  • Trap the GST-fusion protein on GSH immobilized
    96 well plate
  • Detection by peroxidase conjugated anti-GST
    antibody (Amersham)
  • Color development blue-green (ABTS)
  • 5. Purification of GST-fusion proteins.
  • GSH-beads are used for soluble protein
    purification.
  • Combination of SDS-PAGE electro-gel-eluter is
    adapted for in-
  • soluble protein purification.
  • 6. Immunization of rabbit on 49 days schedule.
  • 7. Evaluation for the sensitivity specificity
    of the antibodies.

Kazusa DNA Research Institute
6
  • Multiple evaluation for anti-mKIAA antibodies
  • ELISA for titer determination.
  • 2. Western blot analysis of mKIAA proteins.
  • Lysates prepared from several organs were
    detected by anti-mKIAA ab. Multi-Replica Blotting
    Kit (20/20 GeneSystems) is used for
    high-throughput screening.
  • 3. Immunohistochemical analysis of mKIAA
    proteins.
  • Tissue Array Slide is used for high-throughput
    screening and provides rapid solution for
    localization of mKIAA protein in various mouse
    tissues.
  • 4. Immunohistochemical analysis using
    perfusion-fixed mouse brain.
  • Most of KIAA protein are dominantly expressed in
    brain. Therefore, detail analysis of mKIAA
    proteins in brain provides further insight about
    their functions.
  • 5. Further analysis using anti-mKIAA antibodies.
  • CLSM
  • TEM
  • LC-MS

Kazusa DNA Research Institute
7
Western blot analysis using Multi-Replica
Blotting Kit
Layer 2
samples20mg/lane blockingCasein solution
(Vector Lab) 1st antibodyX 500 2nd
antibodyHRP-conjugated Ig G (Amersham
NA934) detection ECL Plus LAS 1000 Pluse (Fuji)
Layer 5
Layer 9
Layer 10
Kazusa DNA Research Institute
8
Even at layer 10, enough amount of proteins are
transferred for detection on Western blotting
Layer 2 anti-mKIAAOOOOab
Layer 9 anti-mKIAAOOOOab
Layer 5 anti-mKIAAOOOOab
Layer 10 anti-mKIAAOOOOab
9
Protein transfer ratio dose not depend on the
molecular weight and the location of each layer
Layer 9 anti-mKIAAOOOOab
Layer 10 anti-mKIAAOOOOab
Layer 9 anti-mKIAAOOOOab
Layer 9 anti-mKIAAOOOOab
Layer 10 anti-mKIAAOOOOab
Layer 6 anti-mKIAAOOOOab
10
Even in the large proteins (more than 200kDa),
enough amount of proteins are transferred for
detection on Western blotting
Layer 4 anti-mKIAAOOOOab
Layer 5 anti-mKIAAOOOOab
11
Conclusion We herein present the strategy to
isolate mKIAA cDNA clones from size-fractionated
mouse cDNA libraries and to generate mKIAA
antibodies using the in vitro recombination-assist
ed method. Goal of our project is to collect 2000
mouse KIAA cDNAs, to generate 2000 anti-mKIAA
antibodies, and to establish the platforms for
functional analysis of KIAA genes such as cDNA
antibody arrays. These platforms are promising
to be useful for the researchers who are
interested in biological significance of large
proteins.
Write a Comment
User Comments (0)
About PowerShow.com