Title: GFP
1GFP LacZ alpha fusion presentation
- Overview of work done
- Questions I plan to answer 1
- Scope of work 1
- 1 Based upon discussion with Austin Che
2GFP LacZ alpha fusion presentation
- Overview of work done
- Questions I plan to answer 1
- Scope of work 1
- 1 Based upon discussion with Austin Che
3Big picture want dual reporter
GFP
ß-galactosidase (ß-gal)
1 Dual reporter genes enabling cell tracing
with viable and reliable selection of various
cell types C.N. Hwang, S. Hong, S.S. Choi,
K.S. Lee, S.S. Park S.H. Lee Biotechnology
Letters. 2006.
41. Hwang et al GFP full length LacZ fusion
Works
Hwang et al (2006)
C-terminal GFP (red)
11 AA linker
LacZ monomer 1 (Brown)
N-terminal LacZ (yellow)
LacZ monomer 2 (Purple)
LacZ sub-units (purple and brown) N-tern
(yellow) missing three residues (MTM) C-term
(red) none missing
GFP N-term missing two residues (MR) C-term
missing eight residues (HGMDELYK)
52. Austin Che GFP and N-terminal LacZ alpha
fusion Doesnt work
Bba_E0050
C-terminal GFP (red)
No linker
LacZ alpha (blue)
N-terminal LacZ (yellow)
LacZ alpha fragment (blue) N-tern (yellow)
missing three residues (MTM) C-term (red) none
missing
GFP N-term missing two residues (MR) C-term
missing eight residues (HGMDELYK)
63. Austin Che LacZ-alpha and N-terminal GFP
fusion Works
Bba_E0051
N-terminal GFP (yellow)
18 AA linker
C-terminal LacZ (red)
LacZ alpha fragment (blue) N-tern (yellow)
missing three residues (MTM) C-term (red) none
missing
GFP N-term missing two residues (MR) C-term
missing eight residues (HGMDELYK)
74. Austin Che LacZ-alpha and N-terminal GFP
variants
Bba_E0051
Have this with 12 promoter / RBS combinations
LacZ alpha fragment (blue) N-tern (yellow)
missing three residues (MTM) C-term (red) none
missing
GFP N-term missing two residues (MR) C-term
missing eight residues (HGMDELYK)
8GFP LacZ alpha fusion presentation
- Overview of work done
- Questions I plan to answer 1
- Scope of work 1
- 1 Based upon discussion with Austin Che
9- Questions
- 1. Can E0051 be used to report promoter activity?
- Scope of work
- Receive E0051 from Austin
- PCR with BBa sites on primers and with RBS on
forward primer - Insert into flipee vector, downstream of promoter
10- Questions
- 2. Does re-designed E0050 fusion work?
- Scope of work
- Receive E0051 primer designs from Austin
- Design primers for PCR of LacZ and GFP, with
linker / RBS - PCR stitch to create E0050 with linker
Bba_E0050
Insert linker
11- Questions
- 3. How d0 E0050 2.0, E0051, E0050, and full
length fusion compare? - Scope of my work based upon discussions with
Austin - Receive full length GFP fusion from Hwang group
and E0050. - Compare performance of constructs.
12- Questions
- 4. Are GFP/lacZ activities correlated independent
of promoter/RBS? - Scope of my work based upon discussions with
Austin - Evaluate on microplate reader.
13- Questions
- Can E0051 be used to report promoter activity?
- Does re-designed E0050 fusion work?
- How d0 E0050 2.0, E0051, E0050, and full length
fusion compare? - Are GFP/lacZ activities correlated independent of
promoter/RBS? - Scope of work
- Receive E0051, E0051, 12 E0051 variants, primer
designs from Austin - Receive full length GFP fusion from Hwang group
- PCR E0051 w/ BBa sites on primers and with RBS on
forward primer - Insert into flipee vector, downstream of
promoter, test - Design primers for PCR of LacZ and GFP, with
linker / RBS - PCR stitch to create an E0050 with linker
- Compare performance of E0050 2.0, E0051, E0050,
Hwang fusion. - Evaluate promoter/RBS variants on microplate
reader.
14Appendix I Hwang et al
151. LacZ GFP fusion Hwang et al 1 show
fusion protein between GFP and the N-terminal
alpha fragment of full length lacZ
LacZ excised from pMC1817 by Pst1
MCS
Pst1
LacZ
GFP
11 amino acid linker
EcoR1
TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAG
1 Dual reporter genes enabling cell tracing
with viable and reliable selection of various
cell types C.N. Hwang, S. Hong, S.S. Choi,
K.S. Lee, S.S. Park S.H. Lee Biotechnology
Letters. 2006.
161. LacZ GFP fusion It works 1
GFP
ß-galactosidase (ß-gal)
1 Dual reporter genes enabling cell tracing
with viable and reliable selection of various
cell types C.N. Hwang, S. Hong, S.S. Choi,
K.S. Lee, S.S. Park S.H. Lee Biotechnology
Letters. 2006.