Title: Plant Virus Biodiversity and Ecology PVBE
1Plant Virus Biodiversity and Ecology (PVBE)
2Plant Virus Biodiversity and Ecology (PVBE)
- Selling points
- Existing strengths
- Central idea
- Uniqueness
3Strengths
- Plant virology
- Ecology
- Genome Biology
- Bioinformatics
4General Central Idea
Two Worlds of Biological Science
Molecular
Environmental
5One World of Biological Science
Molecular
Environmental
Transformative Research
6Specific Central Idea
7Uniqueness
Plant Virus Evolution
Plant Virus Biodiversity Ecology
Plant Ecology
8Half-way Point
- Where are we?
- Science
- Research Infrastructure
- Broader Impacts
9Science at the Half-way Point
- Biodiversity methods developed (2/3)
- Viruses are frequent
- Viruses are novel
- Other microbes
- Subtle effects of virus infection
ctcctccccagcgagattcatccgtatcagagtgcctgtttcgactattt
ctgcagaaact cccctccccatgaaaaatccatactgcacaacctcccc
ttcagccccacagctctctccac catcaccagctcgatcaaatggctct
caaaatctgctttctccgccctgcccatgcgaatc cgccgagcagccat
agaaaaatcgcaattgccctcctcccatgagaacccagaagtttccc gt
ctagagtctgaattgcttcacaatctccaatagacaatggagactgaacg
agtcctcgt cacccaacctgccatttccactcaaaccgaccttttatcc
gtcccttcttcccccaaccca
10Infrastructure at the Half-way Point
- Further funding
- NSF 5000 Viral Genomes (Roossinck, Roe)
- NSF Plant Virus Ecology Research Coordination
Network (Melcher, Malmström) - USDA-CREES National Needs Fellowships (Fletcher,
Melcher, Allen) - Critical mass
- Kelly Craven
- Andrew Doust
- Five graduate students
- Postdocs
11Outreach at the Half-way Point
12Challenges at the Half-way Point
- What has to be done in 1.5 yrs?
- Speed up biodiversity study
- Facilitate ecology study
- Support for graduate students to complete
degrees - Solidify support large scale funding
- Bottom line at end of 3 yr EPSCoR support we
will have made good progress towards goals, but
will not have quite reached them.
13Center Building
- Reaching out (some examples)
- Plant-associated microbes
- Animal roles in microbe dissemination
(arthropods, bison, nematodes) - NA hybridization complexity (math, chem,
physics) - Plant viruses in natural vs. managed lands
- Microbial roles in LIHD crops
- Forensic microbiology in agricultural
biosecurity - Others?
14Plant Virus Biodiversity and Ecology (PVBE)
Jump on board! Include PVBE in your plans!