The Chemistry of Biotechnology

1
The Chemistry of Biotechnology

• Introduction
• Definitions
• Basic Science
• Applications
• Significance

2
Chemia Biotechnologii

• Wprowadzenie
• Definicje
• Podstawowa nauka
• Zastosowania
• Znaczenie

3
North Carolina State University
Goals for International Program in Poland

• Establish new interactions with researchers
• collaboration
• - joint projects
• - new funding opportunities
• exchange
• - faculty
• - students
• education

4
What is Biotechnology?

• The ability to determine gene sequences and
• manipulate them
• - genes code for proteins
• - recognition and binding events important
• Application to new catalysts and drugs
• - enzymes for industry and bioremediation
• - drugs influence signaling, gene
  transcription, etc.
• Potential to influence evolution at a critical
• stage in human evolution
• - shape environment by breeding new plants
  and animals
• - develop efficient processes and clean up
  waste streams
• - treat diseases at the molecular level

5
Co to jest biotechnologia?

• Umiejetnosc oznaczania sekwencji genu i
• manipulowania nimi
• - geny koduja bialka
• - znaczenie procesów identyfikacji i wiazania
• Zastosowanie do nowych katalizatorów i leków
• - enzymy dla przemyslu i biooczyszczania
• - leki wplywajace na znakowanie, transkrypcje
  genu, itp.
• Potencjalny wplyw na postep w krytycznym
• momencie rozwoju ludzkosci
• - ksztaltowanie srodowiska przez hodowle
  nowych roslin
• i zwierzat
• - rozwój efektywnych procesy utylizacji
  odpadów
• - leczenie chorób na poziomie molekularnym

6
What is Chemistry?

• The understanding of molecular interactions
• that control gene transcription
• - molecular recognition involves specific
  chemical interactions
• - gene transcription requires specific
  enzymatic control
• The development of new catalysts and drugs
• - synthetic approaches are complemented by
  biology
• - the high efficiency of biological catalysis
  is goal
• A science poised to link biology to engineering
• - the genetic breakthrough requires a firm
  understanding and
• synthetic capability to make use of the new
  technology
• - biology is specific, molecular level
  understanding requires
• thinking in terms of specific molecular
  mechanisms

7
Co to jest chemia?

• Zrozumienie oddzialywan molekularnych
• kontrolujacych transkrypcje genu
• - specyficzne interakcje chemiczne wymagajace
  rozpoznania
• molekularnego
• - transkrypcja genu wymaga specyficznej
  kontroli enzymatycznej
• Stworzenie nowych katalizatorów i leków
• - podejscie syntetyczne w porozumieniu z
  biologia
• - celem jest wysoka wydajnosc katalizy
  biologicznej
• Nauka wiazaca biologie z inzynieria
• - przelomowy postep genetyki wymaga doglebnego
  zrozumienia i
• umiejetnosci syntezy w celu wykorzystania
  nowych technologii
• - biologia jest specyficzna, zrozumienie na
  poziomie molekularnym
• wymaga myslenia w kategoriach mechanizmów
  molekularnych

8
The components of DNA

• The individual nucleobases are
• The nucleoside is formed by a bond with the
  ribose sugar at the N9 position of A and G and
  the N6 position of C and T.

9
Skladniki DNA

• Zasady nukleinowe
• Nukleozyd powstaje w wyniku przylaczenia rybozy w
  pozycje N9 dla A i G lub w pozycje N6 dla C i T.

10
The stability of double-helical DNA
The double helical form of DNA is formed by
phosphodiester linkages between the 5 -OH end
of one ribose and the 3-OH of the next. The
double helix is stabilized by hydrogen bonding
in canonical base pairs and by stacking
interactions between the bases.
11
Stabilnosc podwójnej helisy DNA
Podwójna nic DNA tworzy sie dzieki polaczeniom
fosfodiestrowym miedzy grupa 5-OH jednej
rybozy a grupa 3-OH nastepnej. Podwójna
spirala jest stabilizowana przez
wiazania wodorowe pomiedzy komplementarnymi
parami zasad oraz przez oddzialywania
przestrzenne.
12
DNA conformations
A form
Z form
B form
13
Konformacje DNA
Forma A
Forma Z
Forma B
14
Conformations of the ribose

• B is 2-endo anti
• A is 3-endo anti
• Z is 2-endo syn

15
Konformacje rybozy

• B jest 2-endo anti
• A jest 3-endo anti
• Z jest 2-endo syn

16
The first X-ray crystal structure of d(GCGCGC)
was in the Z-form

• Watson-Crick DNA was determined based on fiber
  diffraction. This was B form.
• The expectation that crystalline DNA would also
  be in the B-form was shattered by the structure
  of the hexamer d(GCGCGC)
• Raman and infrared spectroscopy have played a key
  role in comparisons of the various forms of DNA.

17
Pierwsza struktura krystaliczna d(GCGCGC) byla
forma Z

• Watson-Crick okreslil strukture DNA na podstawie
  dyfrakcji promieniowania X na wlóknach DNA. Byla
  to forma B.
• Oczekiwano, ze krystaliczne DNA równiez bedzie w
  formie B. Zaprzeczyly temu badania struktury
  heksameru d(GCGCGC)
• Ramanowska spektroskopia w podczerwieni odegrala
  kluczowa role w badaniach porównawczych róznych
  form DNA.

18
The Dickerson dodecamer
The first x-ray crystal structure of DNA in the
B-form was obtained by Dickerson using the
dodecamer with the sequence d(CGCGAATTCGCG)2. T
he structure shown has the stacking pattern of
B-form DNA found in most DNA in solution. DNA
can, however, be bent or coiled. Coiling is
facilitated by regions of adenines known as
phased A tracts. Such coiling permits
the packing of DNA in structures that for
chromosomes.
19
Dodekamer Dickersona
Pierwsza struktura krystaliczna DNA w formie B
zostala uzyskana przez Dickersona dzieki uzyciu
dodekameru z sekwencja d(CGCGAATTCGCG)2. Przedst
awiona struktura ma ulozenie stackingowe typowe
dla B- formy DNA, która wystepuje glównie w
roztworze DNA. Nic DNA moze byc zgieta lub
zwinieta. Zwijanie struktury jest ulatwione w
obszarze wystepowania adeniny znanej jako faza
obszaru A. Takie pozwijanie struktury pozwala
upakowac DNA w struktury wystepujace w
chromosomach.
20
DNA sequence encodes proteins
DNA Information
transcription mRNA Message
translation Protein sequence Assembly
folding Folded protein Function
21
DNA sekwencja koduje bialka
DNA informacje
transkrypcja mRNA wiadomosc
translacja Sekwencja bialkowa
foldowania/zwiania Sfaldowane bialko
funkcja
22
DNA sequence encodes proteins
Ribosome
DNA Information
transcription mRNA Message
translation Protein sequence Assembly
folding Folded protein Function
23
DNA sekwencja koduje bialka
Ribosome
DNA informacje
transkrypcja mRNA wiadomosc
translacja Sekwencja bialkowa
foldowania/zwiania Sfaldowane bialko
funkcja
24
The codon table
25
Tabela kodonów
26
Translating the DNA sequence
The order of amino acids in any protein is
specificed by the order of nucleotide bases in
the DNA. Each amino acid is coded by the
particular sequence of three bases. To convert a
DNA sequence First, find the starting codon.
The starting codon is always the codon for
the amino acid methionine. This codon is AUG
in the RNA (or ATG in the DNA)
GCGCGGGUCCGGGCAUGAAGCUGGGCCGGGCCGUGC....
Met In this
particular example the next codon is AAG. The
first base (5'end) is A, so that selects the 3rd
major row of the table. The second base (middle
base) is A, so that selects the 3rd column of
the table. The last base of the codon is G,
selecting the last line in the block of four.
27
Translacja sekwencji DNA
Kolejnosc ulozenia aminokwasów w kazdym bialku
jest zdeterminowana kolejnoscia ulozenia
nukleozasad umiejscowionych w DNA. Kazdy
aminokwas jest zakodowany poprzez okreslona
sekwencje trzech zasad. Konwersja sekwencji
DNA Najpierw, odszukanie poczatkowego kodonu.
Kodon startowy jest zawsze kodonem dla
aminokwasu metioniny. Kodon ten to AUG w RNA
(albo ATG w DNA) GCGCGGGUCCGGGCAUGAAGCUGGGCCGGG
CCGUGC....
Met W tym szczególnym przypadku nastepnym
kodonem jest AAG. Pierwsza zasada (na koncu 5)
jest A, stad wybór trzeciego glównego wiersza w
tabeli. Druga zasada (srodkowa zasada) jest A,
zatem nalezy wybrac trzecia kolumne w tabeli.
Ostatnia zasada kodonu to G, a wiec nalezy wybrac
ostatni wers, jeden z czterech w bloku.
28
Translating the DNA sequence
This entry AAG in the table is Lysine (Lys).
Therefore the second amino acid is Lysine.
The first few residues, and their DNA sequence,
are as follows (color coded to indicate the
correct location in the codon table) Met
Lys Leu Gly Arg ... AUG AAG CUG
GGC CGG GCC GUG C.. This procedure is exactly
what cells do when they synthesize proteins based
on the mRNA sequence. The process of
translation in cells occurs in a large complex
called the ribosome.
29
Translacja sekwencji DNA
Kolejnosc ulozenia aminokwasów w kazdym bialku
jest zdeterminowana kolejnoscia ulozenia
nukleozasad umiejscowionych w DNA. Kazdy
aminokwas jest zakodowany poprzez okreslona
sekwencje trzech zasad. Konwersja sekwencji
DNA Najpierw, odszukanie poczatkowego kodonu.
Kodon startowy jest zawsze kodonem dla
aminokwasu metioniny. Kodon ten to AUG w RNA
(albo ATG w DNA)
GCGCGGGUCCGGGCAUGAAGCUGGGCCGGGCCGUGC....

Met W tym szczególnym przypadku nastepnym
kodonem jest AAG. Pierwsza zasada (na koncu 5)
jest A, stad wybór trzeciego glównego wiersza w
tabeli. Druga zasada (srodkowa zasada) jest A,
zatem nalezy wybrac trzecia kolumne w tabeli.
Ostatnia zasada kodonu to G, a wiec nalezy wybrac
ostatni wers, jeden z czterech w bloku.
30
DNA sequence encodes proteins
Folding intermediates of apomyoglobin
DNA Information
transcription mRNA Message
translation Protein sequence Assembly
folding Folded protein Function
U unfolded E early intermediate I
intermediate N native
31
Sekwencja DNA koduje bialka
Zwiniete produkty posrednie apomioglobiny
DNA informacje
transkrypcja mRNA wiadomosc
translacja Sekwencja bialkowa
foldowania/zwiania Sfaldowane bialko funkcja
U niezwiniety E wczesny produkt posredni I
produkt posredni N bialko natywne
32
Levels of Protein Structure Secondary Structure
ordering along short stretches of the protein
b-sheets
a-helices
33
Poziomy struktury bialka struktura drugorzedowa
uporzadkowanie krótkich odcinków bialka
b-kartki
a-helisy
34
Levels of Protein Structure Tertiary Structure
overall conformation of the protein chain
information contained in the proteins sequence
of residues is sufficient to dictate the specific
3-dimensional structure that the chain will adopt
(native state)
35
Poziomy struktury bialka struktura trzeciorzedowa
ogólna konformacja lancucha bialkowego
informacja zawarta w sekwencji aminokwasów w
lancuchu bialka determinuje specyficzna
trzeciorzedowa strukture, która przyjmuje lancuch
bialkowy (forma natywna)
36
Mutations

• A gene is a blueprint for construction of
  protein.
• Any change in a DNA sequence is called a
  mutation.
• The change may result in a protein that does not
  fold
• or that is not functional.
• There are controlling sequences that determine
• whether a gene will be expressed.
• Changes in these controlling sequences can
  result
• in altered levels of protein expression in a
  cell.
• Altering DNA sequences is a basic research tool
• and is an important tool in biolotechnology.
• The tool for making mutations are part of
  molecular
• biology. The job of analyzing the result of
  mutations
• is a research area for chemistry.

37
Mutacje

• Gen jest planem budowy bialka.
• Jakakolwiek zmiana w sekwencji DNA nazywana jest
  
• mutacja.
• Zmiana moze powodowac, ze bialko nie zwija sie
• lub nie jest funkcjonalne.
• Sa sekwencje kontrolujace, które determinuja czy
  gen
• ulegnie ekspresji.
• Zmiany w sekwencjach kontrolujacych moga
  powodowac
• zmiany w poziomach ekspresji bialek w
  komórkach.
• Zmieniajace sie sekwencje DNA sa podstawowym
• narzedziem badan i waznym narzedziem w
  biotechnologi.
• Tworzeniem mutacji zajmuje sie biologia
  molekularna.
• Analiza rezultatów mutacji jest obszarem badan
  dla chemii.

38
DNA sequencing by the Sanger method
The standard DNA sequencing technique is the
Sanger method, named for its developer,
Frederick Sanger, who shared the 1980 Nobel
Prize in Chemistry. This method begins with the
use of special enzymes to synthesize fragments
of DNA that terminate when a selected base
appears in the stretch of DNA being sequenced.
These fragments are then sorted according to size
by placing them in a slab of polymeric gel and
applying an electric field -- a technique called
electrophoresis. Because of DNA's negative
charge, the fragments move across the gel toward
the positive electrode. The shorter the
fragment, the faster it moves. Typically, each of
the terminating bases within the collection of
fragments is tagged with a radioactive probe
for identification.
39
Metoda Sangera szeregowania DNA
Podstawowa technika szeregowania DNA jest metoda
Sangera, nazwa pochodzi od jego odkrywcy,
Frederick Sanger, który 1980 otrzymal Nagrode
Nobla w dziedzinie chemii. Metoda ta zaczyna sie
od wykorzystania specjalnego enzymu do
zsyntetyzowania fragmentu DNA tego koncowego,
gdy wybrana zasada pojawia sie w obszarze DNA
zaczyna byc szeregowana. Te fragmenty wtedy sa
oddzielane zgodnie z wielkoscia przez
klasyfikowanie ich w plycie z polimerowym zelem
i stosowanie pole elektryczne - metoda nazwana
(elektroforeza). Z powodu ujemnego naladowania
DNA, fragmenty poruszaja w poprzek zelu w
kierunku dodatniej elektroda. Im krótszy
fragment, tym szybciej sie porusza. Zwykle,
kazdy z konczacych sie spodów wewnatrz zbiór
fragmentów jest etykietowany z promieniotwórcza
próbka dla identyfikacji.
40
DNA sequencing example
Problem Statement Consider the following DNA
sequence (from firefly luciferase). Draw the
sequencing gel pattern that forms as a result of
sequencing the following template DNA with ddNTP
as the capper. Solution The ddNTP is a
dideoxy nucleoside triphosphate. When it is
incorporated into the sequence, the sequence is
terminated. Given DNA template
5'-atgaccatgattacg...-3' DNA synthesized
3'-tactggtactaatgc...-5'

41
Przyklad DNA sekwensowania
Postawienie problemu Rozwaz nastepujaca
sekwencje DNA. Narysuj wzór zelu, który sie
formuje jako rezultat dzielenia nastepujacego
wzoru DNA Rozwiazanie ddNTP jest dideoxy
nucleoside triphosphate kiedy sie to wlaczy w
sekwencje, sekwencja jest ukonczona. Dany
DNA szablon 5'-atgaccatgattacg...-3
' DNA syntetyzowana 3'-tactggtactaatgc...-5

42
DNA sequencing example
Given DNA template 5'-atgaccatgattacg...-3'
DNA synthesized 3'-tactggtactaatgc..
.-5' Gel pattern lane ddATP
lane ddTTP
lane ddCTP
lane ddGTP


Electric Field
where indicates the well
position, and "" denotes the DNA bands on the
sequencing gel.
-

43
DNA sekwencja Przyklad
Given DNA template 5'-atgaccatgattacg...-3'
DNA synthesized 3'-tactggtactaatgc..
.-5' Gel pattern lane ddATP
lane ddTTP
lane ddCTP
lane ddGTP


Electric Field
where indicates the well
position, and "" denotes the DNA bands on the
sequencing gel.
-

44
A sequencing gel
This picture is a radiograph. The dark color of
the lines is proportional to the radioactivity
from 32P labeled adenonsine in the transcribed
DNA sample.
45
A sequencing gel
Ten obraz jest radiogramem. ciemny kolor linii
jest proporcjonalny do promieniotwórczosci z 32P
opatrzony etykieta adenonsine w spisanej DNA
próbce.
46
Reading a sequencing gel
You begin at the right, which are the smallest
DNA fragments. The sequence that you read will
be in the 5'-3' direction. This sequence will be
exactly the same as the RNA that would be
generated to encode a protein. The difference is
that the T bases in DNA will be replaced by U
residues. As an example, in the problem given,
the smallest DNA fragment on the sequencing gel
is in the C lane, so the first base is a C. The
next largest band is in the G lane, so the DNA
fragment of length 2 ends in G. Therefore the
sequence of the first two bases is CG. The
sequence of the first 30 or so bases of the DNA
are CGTAATCATGGTCATATGAAGCTGGGCCGGGCCGTGC....
When this is made as RNA, its sequence would
be CGUAAUCATGGUCAUAUGAAGCUGGGCCGGGCCGUGC....
Note that the information content is the same,
only the T's have been replaced by U's!.
47
Odczytywanie zelu sekwencyjnego
Zaczyna sie od prawej strony, gdzie sa
najmniejsze fragmenty DNA. Sekwencja jest
odczytywana od konca 5 do 3.Sekwencja bedzie
dokladnie taka sama jak sekwencja RNA, utworzona
do kodowania bialka. Róznica polega na tym, ze
miejsce T w DNA zastepuje w RNA U. Na przyklad
najmniejszy fragment DNA w zelu jest polozony w
sciezce C, wiec pierwsza zasada jest C. Kolejny
najdluzszy lancuch znajduje sie w sciezce G, stad
wniosek, ze druga zasada jest G, wiec pierwsze 2
nukleotydy w sekwencji, to CG. Sekwencja
pierwszych 30 zasad w analizowanym
DNA CGTAATCATGGTCATATGAAGCTGGGCCGGGCCGTGC.... Prz
edstawiajac to jako RNA otrzymuje
sie CGUAAUCATGGUCAUAUGAAGCUGGGCCGGGCCGUGC.... Inf
ormacja, zawarta w tych sekwencjach jest taka
sama, róznia sie tylko tym, ze zamiast T
wystepuje U.
48
Automated procedure for DNA sequencing
A computer read-out of the gel generates a false
color image where each color corresponds to a
base. Then the intensities are translated into
peaks that represent the sequence.
49
Zautomatyzowana procedurasekwencjonowania DNA
Na podstawie komputerowego odczytu z zelu
generuje sie kolorowy obraz, gdzie kazdy kolor
odpowiada konkretnej zasadzie. Nastepnie
intensywnosci sa przekladane na piki,
reprezentujace sekwencje.
50
High-throughput seqeuncingCapillary
electrophoresis
The human genome project has spurred an effort
to develop faster, higher throughput, and less
expensive technologies for DNA sequencing.
Capillary electrophoresis (CE) separation has
many advantages over slab gel separations. CE
separations are faster and are capable of
producing greater resolution. CE instruments can
use tens and even hundreds of capillaries
simultaneously. The figure show a simple CE setup
where the fluorescently-labeled DNA is detected
as it exits the capillary.
Sheath flow
Laser
Focusing lens
Sheath flow cuvette
Beam block
Collection Lensc
Collection Lensc
PMT
filter
51
Wysoko wydajne sekwencjonowanieElektroforeza
kapilarna
Projekt sekwencjonowania ludzkiego genomu byl
impulsem do wynalezienia szybszych,
wydajniejszych, tanszych metod
sekwencjonowaniaDNA. Rozdzielanie przy pomocy
elektroforezy kapilarnej (CE) przynioslo wiele
korzysci w stosunku do rozdzielania w zelu.
Rozdzielanie metoda CD jest szybsze i moze dawac
lepsze rezultaty. W CE mozna stosowac
jednoczesnie dziesiatki, a nawet setki kapilar.
Obrazek przedstawia prosty uklad do CE, gdzie
znakowane fluorescencyjnie DNA jest wykrywane w
momencie, gdy opuszcza kapilare.
Sheath flow
Laser
Focusing lens
Sheath flow cuvette
Beam block
Collection Lensc
Collection Lensc
PMT
filter
52
Fluorescent end labeling of DNA
53
Fluorescencyjne znakowanie konców DNA
54
RNA amplification and labeling by reverse
transcription

• Sample must be reverse transcribed and
  re-transcribed
• The process of making a DNA copy of RNA is known
  as
• reverse transcription. The enzyme, which carries
  out this
• process is a reverse transcriptase.

Fluorophore
Fluorophore
mRNA
Fluorophore
Fluorophore
Labeled antisense DNA
cDNA
55
Powielanie i znakowanie RNA w reakcji odwrotnej
transkrypcji.

• Próbka musi byc poddana odwrotnej transkrypcji i
  re-transkrypcji
• Proces tworzenia DNA jako kopii RNA znany jest
  jako odwrotna transkrypcja. Enzym uczestniczacy w
  tym procesie, to odwrotna transkryptaza.

Fluorofor
Fluorofor
mRNA
Fluorofor
Fluorofor
Znakowany antysensowny DNA
cDNA
56
RNA and DNA hybridization
DNA Array Technology
57
Hybrydyzacja RNA i DNA
DNA Array Technology
58
DNA arrays
DNA Array Technology
DNA arrays are tools to determine Genomic
sequences Gene expression Levels Advantages of
DNA arrays High throughput Fast screening
compared to traditional screening
techniques Potential pitfalls Possibility of
false positives Due to mismatches Lack of
dynamic range due to Base mismatches Statistical
analysis required
cDNA Target
Probe B
Probe B
Probe B
Probe C
Probe C
Probe C
Probe D
Probe D
Probe D
DNA Array, Overall Principle
59
Macierze DNA
DNA Array Technology
Macierze DNA sa narzedziem, pozwalajacym okreslic
Sekwencje genomu Stopien ekspresji
genów Korzysci, jakie daja macierze DNA Wysoka
wydajnosc Szybkie, w porównaniu z tradycyjnymi
metodami Potencjalne zagrozenia Prawdopodobiens
two falszywie pozytywnych wyników wynikajace z
niesparowan Brak dynamicznego przedzialu
wartosci wynikajacy z niesparowanych
zasad Wymagana analiza statystyczna
cDNA Target
Probe B
Probe B
Probe B
Probe C
Probe C
Probe C
Probe D
Probe D
Probe D
DNA Array, Overall Principle
60
GeneChipTM Technology
DNA Array Technology
61
Polymerase chain reaction
Who would have thought a bacterium hanging out in
a hot spring in Yellowstone National Park would
spark a revolutionary new laboratory technique?
The polymerase chain reaction, now widely used
in research laboratories and doctor's offices,
relies on the ability of DNA-copying enzymes to
remain stable at high temperatures. The
polymerase from Thermus aquaticus (Taq), a
bacterium from Yellowstone can produce millions
of copies of a single DNA segment in a matter of
hours. In nature, most organisms copy their DNA
in the same way. PCR mimics the natural process,
only it does it in a test tube. When any cell
divides, enzymes called polymerases make a copy
of all the DNA in each chromosome. The first
step in this process is to "unzip" the two DNA
chains of the double helix. As the two strands
separate, DNA polymerase makes a copy using each
strand as a template.
62
Lancuchowa reakcja polimerazy
Kto móglby pomyslec, ze bakterie, zyjace w
goracych zródlach w Parku Yellowstone spowodowac
stworzenie nowej techniki laboratoryjnej?
Lancuchowa reakcja polimerazy, obecnie szeroko
stosowana w laboratoriach naukowych polega na
zdolnosci enzymów kopiujacych DNA do pozostawania
stabilnymi w wysokich temperaturach. Polimeraza
Termus Aquaticus, bakterii z Yellowstone moze
produkowac miliony kopii pojedynczych lancuchów
DNA w przeciagu godzin. W naturze wiekszosc
organizmów kopiuje DNA w ten sam sposób. PCR
nasladuje naturalny proces, tyle, ze w probówce.
Kiedy komórki dziela sie enzymy, nazwane
polimerazami, tworza kopie wszystkich lancuchów
DNA w chromosomie. Pierwszm krokiem w tym
procesie jest rozplecenie podwójnej helisy. Kiedy
nici sa rozdzielone wtedy polimeraza DNA tworzy
ich kopie uzywajac kazdej z nich jako matrycy.
63
The role of the primer
To copy DNA, polymerase requires two other
components 1. a supply of the four nucleotide
bases 2. a primer. DNA polymerases, whether from
humans, bacteria, or viruses, cannot copy a
chain of DNA without a short sequence of
nucleotides to "prime" the process, or get it
started. So the cell has another enzyme called a
primase that actually makes the first few
nucleotides of the copy. This stretch of DNA is
called a primer. Once the primer is made, the
polymerase can take over making the rest of the
new chain.
64
Rola starterów

• By skopiowac DNA, polimeraza wymaga dwóch
  skladników
• Obecnosci wszystkich czterech nukleotydów
• Startera
• Polimerazy DNA, lacznie z ludzkimi, bakteryjnymi,
  czy wirusowymi nie moga skopiowac lancucha DNA
  bez krótkiej sekwencji nukleotydowej do
  wystartowania czyli zapoczatkowania reakcji
  (startera). Komórki posiadaja wiec inne enzymy
  prymazy które tworza poczatek lancucha. Ten
  odcinek DNA nazywany jest starterem. Kiedy
  starter jest utworzony, polimeraza DNA moze za
  nim dobudowac reszte nowego lancucha.

65
Step I DNA melting
The three parts of the polymerase chain reaction
are carried out in the same vial, but at
different temperatures. The first part of the
process separates the two DNA chains in the
double helix. This is done simply by heating the
vial to 95 oC for 30 seconds.
double-stranded DNA single-stranded
DNA
66
Krok I Rozplatanie DNA
Wszystkie trzy czesci reakcji lancuchowej
polimerazy (PCR) przeprowadza sie w tym samym
naczyniu, lecz w róznych temperaturach. W
pierwszym etapie, podwójna helisa DNA rozdzielana
jest na dwa osobne lancuchy. W tym celu nalezy
jedynie ogrzac próbke na 30 sekund do 95 oC.
Podwójny lancuch DNA pojedynczy
lancuch DNA
67
Step II Primer annealing
The primers cannot bind to the DNA strands at
such a high temperature, so the vial is cooled
to 55 oC. At this temperature, the primers bind
or "anneal" to the appropriate location in the
DNA strands. This takes about 20 seconds.
single-stranded DNA primer
annealed DNA The final step of the reaction is
to make a complete copy of the templates. Since
the Taq polymerase works best at ca. 75 oC, the
temperature of the vial is raised.
68
Krok II Przylaczanie startera
Jako ze startery nie sa w stanie przylaczyc sie
do DNA w tak wysokiej temperaturze, naczynie
schladza sie do 55 oC. W tych warunkach,
czasteczki startera wiaza sie (lub wyzarzaja) w
odpowiednim miejscu w lancuchu DNA. Zajmuje to
ok. 20 sekund. Pojedyncze lancuchy DNA
starter DNA z przylaczonym startere
m Ostatnim etapem reakcji jest stworzenie pelnej
kopii wzorców. Poniewac polimeraza Taq dziala
najlepiej w ok. 75 oC, naczynie ogrzewa sie do
tej temperatury.
69
Step III Primer extension
The Taq polymerase begins adding nucleotides to
the primer and eventually makes a complementary
copy of the section of the template that lies
between the primers. This completes one PCR
cycle. primer-annealed DNA
primer-extended DNA with Taq polymerase and dATP,
dTTP, dGTP, dCTP
70
Krok III wydluzanie startera
Polimeraza Taq zaczyna dodawac nukleotydy do
startera i ostatecznie tworzy komplementarna
kopie fragmentu wzorca, lezacego pomiedzy
starterami. W ten sposób konczy sie jeden cykl
PCR. DNA z przylaczonym star- DNA
z dobudowa- tere, polimeraza Taq oraz nym
fragmentem dATP, dTTP, dGTP, dCTP
71
Thermal cycling
At the end of a cycle, each piece of DNA in the
vial has been duplicated. Since the cycle can be
repeated 30 or more times and each newly
synthesized DNA piece can act as a new template,
one can obtain 230 or ca. 1 million copies of a
single piece of DNA.
amplified
region Note that the region of the DNA between
the two primers will be amplified. The flanking
sequences not. The entire process takes about
three hours.
72
Cykl termiczny
Pod koniec cyklu, kazda z czesci DNA w fiolce
jest zduplikowana. Jako, ze cykl ten mozna
powtarzac ponad 30 razy, a kazda zsyntetyzowana
czasteczka DNA moze stanowic nowy wzorzec, mozna
w ten sposób otrzymac 230, czyli ok 1 mln kopii
danego fragmentu DNA.
Region wzmocniony Zwrócmy
uwage, ze fragment DNA pomiedzy dwoma starterami,
w przeciwienstwie do fragmentów bocznych,
zostanie wzmocniony. Calosc procesu zajmuje ok.
3h.
73
Wzmacnianie PCR
Rysynek po lewej przedstawia serie kroków w
jednym cyklu. Powyzej zilustrowany jest
wykladniczy wzrost segmentu podwójnej helisy,
który znajduje sie pomiedzy starterami.
74
Polimeraza Taq
Kompleks polimerazy Taq z Tp7 - przeciwcialem
inhibitujacym
75
Cloning into a plasmid
The procedure begins with the insertion of a DNA
sequence of interest into a plasmid. A plasmid
is a circular piece of dsDNA (typically 3 kb).
The plasmid can be isolated from E. coli and
manipulated using cutting enzymes known as
restriction endonucleases. Once the plasmid is
cut the target gene (DNA sequency of interest)
will bind to complementary "sticky ends." The
ends of gene can be made to match the sequence
cut by a particular restriction endonuclease by
appropriate design of the primer used in PCR. The
opened plasmid and the gene are allowed mix and
are then bonded by an enzyme called DNA ligase,
which reforms the two pieces as recombinant DNA.
The plasmid carries also genes for antibiotic
resistance that will be once the plasmid is
introduced into a cell.
76
Klonowanie w plazmidzie
Procedura rozpoczyna sie od wstawienia sekwencji
DNA do plazmidu. Plazmid jest kolistym fragmentem
dsDNA (zwykle wielkosci ok. 3 kb). Plazmid mozna
wyizolowac z E. coli i manipulowac nic przy
wykorzystaniu enzymów zwanych endonukleazami
restrykcyjnymi. Po rozcieciu plazmidu, gen
docelowy (interesujaca nas sekwencja DNA)
przylacza sie do komplementarnych lepkich
konców lancucha. Konce genu dopasowuje sie do
sekwencji wycietej przez dana endonukleaze
restrykcyjna poprzez wybór odpowiedniego startera
w PCR. Po wymieszaniu otwartego plazmidu i genu,
laczy sie je w jedna calosc przy uzyciu enzymu
zwanego ligaza DNA. Plazmid zawiera takze geny
odpowiedzialne za odpornosc na antybiotyki, która
objawia sie po wprowadzeniu plazmidu do komórki.
77
Rozcinanie Ligacja (przylaczanie) Transformac
ja Selekcja
78
Significance
The tools described here provide the basis
for sequencing and manipulating the genome. We
can understand cell development,
biological chemistry and disease using these
tools. The development of new enzymes and
processes result from the cloning of genes in the
expression vectors of E. Coli and using the
baculovirus. We can study disease states and
target them using peptide drugs, drug design and
gene therapy.
79
Znaczenie
Przedstawione tutaj narzedzia stanowia podstawe
dla sekwencjonowania i manipulacji genomem.
Uzywajac ich, jestesmy w stanie zrozumiec rozwój
komórki, chemie biologiczna i choroby. Klonowanie
genów w wektorach ekspresji E. Coli przy uzyciu
bakulowirusów sluzy równiez rozwojowi nowych
enzymów i procesów. Mozna w ten sposób badac
stany chorobowe i próbowac znalezc na nie
rozwiazanie projektujac nowe lekarstwa, leki
peptydowe, lub terapie genowe.
80
The Role of Spectroscopy

• Spectroscopy is a key method for detecting
• biological molecules and binding interactions.
• It is useful for DNA sequencing, detection of
  DNA and proteins on chips, assays for screening
• new drugs and many other applications. In this
• Course we will describe the applications of
• spectroscopy including
• Absorption and Fluorescence (energy transfer)
• Vibrational Raman and Infrared Spectroscopy
• Ultraviolet Circular Dichroism

81
Rola Spektroskopii
Spektroskopia jest kluczowa metoda wykrywania
czasteczek biologicznych oraz oddzialywan
wiazacych. Wykorzystuje sie ja w sekwencjonowaniu
DNA, wykrywaniu DNA i bialek w mikromacierzach,
testach na obecnosc narkotyków i wielu innych
zastosowaniach. W ramach tego kursu opiszemy
nastepujace zastosowania spektroskopii 1.
Absorpcje i fluorescencje (przekazanie
energii) 2. Spektroskopia wibracyjna Raman i
IR 3. Dichroizm kolowy promieniowania UV