Microbial Cause of Calcium Lactate Defect in Cheddar Cheese

1
Microbial Cause of Calcium Lactate Defect in
Cheddar Cheese

• Boorus Yim
• California Polytechnic State University
• San Luis Obispo
• Dairy Product Technology Center

December 8, 2005
2
History of Cheese

• Cheese was known 6000 years ago by the ancient
  Sumarians. The ancient Greeks accredited
  Aristaeus, son of Apollo and Cyrene, with its
  discovery. The ancient Romans claim cheese came
  on its own.
• Ancient legend first describes cheese when an
  Arabian merchant traveling through the desert was
  carrying milk in an animals stomach. The
  combination of the heat and rennet in the stomach
  separated the milk into curds (cheese) and whey.
• Cheesemaking was brought over to Europe from
  Asia, including northern Africa.
• Cheesemaking was brought over to current day
  United States when the Pilgrims landed in 1620.
• Cheesmaking was a local farm industry until in
  1851 a cheese cooperative with local cheese
  makers and dairy farmers was formed by Jesse
  Williams in Oneida, New York.
• Big Cheese 1801, an enterprising cheesemaker
  made a 1,225 lb wheel of cheese to Thomas
  Jefferson.

3
Cheese Industry

• 2003 8.598 billion pounds of cheese in the U.S.
  market
• Italian and American type cheeses dominate the
  market at 3.522 billion and 3.67 billion pounds,
  respectively.
• Cheddar cheese comprises most of the American
  type cheese produced at 2.749 billion pounds.
• Estimated 300 varieties of cheese in the U.S.
• Cheese defects range from physical to chemical.

4
Calcium Lactate Crystal (CLC) Defect

• First described in 1930s as formation of white
  specks. Identified on Cheddar cheese.
• 1980s White specks on cheddar cheese classified
  as calcium lactate crystal.
• CLCs pose no health hazard to the consumer.
• CLCs detract from the appearance of the cheese
  since they look like mold to the general
  consumer. Crystals obvious against the
  background of yellow colored Cheddar cheese.
• Chemical Formula - C6H10CaO6
• MW 2182214
• Calcium lactate is sold as vitamin supplements
  and as chemical agents.

5
How do CLCs form in cheese?

• In theory, CLCs form when theres a racemic
  mixture of L()-lactic acid and the less soluble
  D(-)-lactic acid with free calcium in the cheese
  serum (moisture expulsion).
• Proposed by Dybing, et. al. (Land OLakes, Inc.,
  Cheese Research Group, RD)

6
How do CLCs form in cheese? (cont.)

• Dybing et al. (1988) proposed several causes to
  CLC formation.
• Physical causes Packaging (temperature, CO2 vs.
  vacuum), length of curing, seasonal effects
• Chemical causes D to L-lactic acid content,
  free Ca ion content, salt concentration, pH at
  milling, rate of acidification during
  manufacture.
• Several more studies showed non-starter lactic
  acid bacteria (NSLAB) and D-lactic acid as a
  possible underlying cause to CLCs.
• Johnson et al. (1990) used an unidentified strain
  of Lactobacillus. Found when used, crystals
  would form and noticed an increase of D-lactic
  acid.
• Thomas and Crow (1983) found mature Cheddar
  cheese contained a racemic mixture of lactic
  acid. But the Lactococci produces L-lactic acid.
  They found L and D lactate dehydrogenase
  produced by Pediococci and some Lactobacillus
  species.
• Generally accepted that NSLAB causes CLCs.
  Agarwal et al. (2003) and Chou et al. (2003)
  narrowed the possible NSLAB to Lb. curvatus and
  P.acidlactici.

7
Non-Starter Lactic Acid Bacteria (NSLAB)

• Generally defined as a lactic acid producing
  bacterium introduced post-manufacture.
• One method of NSLAB classification is by the
  sugars and the metabolic pathway utilization.
• Obligately homofermentative Glycolysis
• Obligately heterofermentative
  6-phosphogluconate/phospoketolase (6-PG/PK)
• Facultative heterofermentative May use both
  Glycolysis and 6-PG/PK pathways
• Lb. casei, Lb. plantarum, Lb. sake, Lb. curvatus
• Lb. curvatus Gram positive single rods with a
  slight moon shape curve. Commonly found in
  fermented foods such as sausage and sauerkraut.
• Produces the enzyme lactate dehydrogenase that
  yield lactic acid.

8
Lactate Dehydrogenase (Ldh)

• Dehydrogenases belong to the EC 1.1 class of
  enzymes.
• Transfer a hydride ion (H-) to an acceptor such
  as nicotinamide adenine dinucleotide (NAD),
  oxygen, quinone, or cytochrome.
• Lactate dehyrogenase catalyzes the reaction from
  pyruvate (glycolysis) to lactic acid
  (fermentation).
• D and L lactate dehydrogenase have been
  identified and produces stereoisomers of lactic
  acid.
• 140 kDa for both D and L forms of LDH

9
Lactic Acid
10
Lactic Acid

• Byproduct of lactic acid fermentation
• Skeletal muscle under strenuous exercise undergo
  lactic acid fermentation
• Cheese ripening occurs under anaerobic
  conditions, allowing for lactic acid fermentation
• C3H6O3
• MW 90.0786 g/mole
• Two isomers of lactic acid
• L()-lactic acid produced normally from
  commercial cheese starter cultures (mesophillic
  Lactococci)
• D(-)-lactic acid not normally produced,
  specifically seen if there is the presence of
  D-LDH.

11
Objectives

• Isolate NSLAB from cheese with CLC defect.
• Identify NSLAB isolated from cheese with CLC
  defect.
• Use isolated organism as an adjunct to produce
  CLC defect in cheese.
• Isolate the D(-)-ldh gene from the organism used
  to produce the CLC defect in cheese.

12
Materials and Methods The Cheese

• Bulk Cheese from Wisconsin, Asiago Cheddar,
  Tillamook Cheddar, New Zealand and Iceland type
  Cheddar, and Edam Gouda were received.
• The cheese from Wisconsin, Asiago Cheddar, and
  New Zealand and Iceland type Cheddar exhibited
  CLCs.
• Tillamook Cheddar (store bought) and Edam Gouda
  did not show signs of CLCs.
• Each cheese was cut into smaller blocks, grated,
  packaged and stored _at_2-3ºC for analysis.

13
Materials and Methods Objective 1

• Isolate NSLAB from cheese with CLC defect
• 10g from each cheese was added to 90 mL 2
  trisodium citrate (TSC) solution (10-1) and
  homogenized with a stomacher.
• 10-2 10-6 serial dilutions were made with 9 mL
  Butterfields buffer with corresponding pour
  plates (enumeration) and streak plates (isolated
  bacteria).
• Rogosa SA and MRS agar were the primary agars
  used to isolate and enumerate bacteria.
• Rogosa SA Incubated 3-4 days, anaerobic
  conditions, 37ºC
• MRS agar Incubated 1-2 days, anaerobic
  conditions, 37ºC
• Isolated bacteria were cultivated and further
  stored in MRS broth.
• For frozen storage, the bacteria was suspended in
  S buffer and glycerol.
• Averaged to 80 bacterial isolated

14
Materials and Methods Objective 2

• Identify NSLAB isolated from cheese with CLC
  defect
• Gram staining visual observation
• 16S rRNA Polymerase Chain Reaction (PCR) rRNA
  isolation
• Genomic DNA purification of each isolated
  bacteria. Used a DNA isolation kit (MoBio
  Laboratories, Inc., Solana Beach, CA)
• PCR Used universal primers UF2 and UR523 for
  16S rRNA isolation
• 94ºC 2 min, (94ºC 15 sec, 55ºC 1 min, 72ºC 1.5
  min) 30, 72ºC 7 min.
• PCR product cleaned with a PCR clean up kit
  (MoBio Laboratories, Inc., Solana Beach, CA)
• PCR product sequencing
• Cleaned PCR products were sent to Utah State
  University Biotechnology Center for sequencing.
  Used an ABI Prism 3730 DNA analyzer and Taq FS
  Terminator Chemistry.
• Sequences were sent back and used BLAST software
  (National Center of Biotechnology Information
  Center) to identify the bacteria.

15
Materials and Methods Objective 3

• Use isolated organism as adjunct to produce CLC
  defect in cheese
• BUT WAIT!! We needed to figure out what was the
  proper adjunct.
• The proper adjunct must be
• NSLAB
• Evidence the NSLAB can produce D-LDH
• Produces a large amount of D(-)-lactic acid
• A DL-Lactic Acid Assay Kit (Biopharm, Inc.,
  Marshall, MI) was used to determine how much D(-)
  and L()-lactic acid each isolated bacteria
  produced.
• When the proper adjunct was chosen, the NSLAB was
  grown in 150 mL MRS broth for 16-20 hours before
  the day of cheesemaking.

16
Material and Methods - Cheesemaking
Milk
C (Control) 60 gal
Experimental 60 gal
Gas Flushed 20 lb block
Vacuumed Packaged 20 lb block
A (no CaCl2)
A (CaCl2)
Gas Flushed 10 lb block
Vacuumed Packaged 10 lb block
Gas Flushed 10 lb block
Vacuumed Packaged 10 lb block
17
Materials and Methods Cheese Sampling and
Analysis

• Aseptic sampling of each cheese block on day 1
  (before first packaging), day 7, day 30, day 60,
  and day 90 from date of manufacture. Half the
  sample was grated and the other half stored
  frozen.
• Exception was if crystals were observed early,
  stop sampling.
• Cheese analysis includes
• Composition fat (), moisture (), pH,
  DL-lactic acid content.
• Microbiology Rogosa SA and MRS Agar bacterial
  enumeration

18
Materials and Methods Objective 4

• Isolate the D-ldh gene from the organism used to
  produce the CLC defect.
• We used specific custom primers to isolate a
  fragment of the D-ldh gene and used PCR to
  amplify the fragment.
• PCR product sent to Utah State University
  Biotechnology Center for sequencing.
• Sequences were compared to published D-ldh gene
  sequences using Clustal W.

19
Results and Discussion

• 80 bacterial isolates 60 isolates from cheeses
  with the CLC defect, 20 isolates from cheeses
  with no signs of CLCs.
• 2/3 of the 60 isolates were identified as Lb.
  curvatus
• Remaining isolates identified as Lb. casei, Lb.
  paracasei, Lb. coryniformus.
• 23 isolates were screened for D and L-lactic
  acid. 7 of the isolates later identified as Lb.
  curvatus were the isolates positive for
  D(-)-lactic acid content.
• An isolate was selected at random from the 7
  identified as Lb. curvatus to be used as an
  adjunct.

20
Results and Discussion

• Compositional Analysis of cheeses
• Average cheese fat content met the requirement of
  50 of the cheese solids and cheese moisture met
  the requirement of up to a maximum of 39 by
  weight.
• Food and Drug Administration (FDA), Code of Food
  Regulation, Title 21, Section 133.113.

21
Results and Discussion

• NSLAB counts from preliminary trial and trial
  cheeses.

22
Results and Discussion

• When did crystals form?
• Preliminary trial Control cheese showed no
  signs of CLCs. Vacuumed packaged cheese showed
  CLCs 180 days of ripening. Gas flushed packaged
  cheese showed CLCs 150-160 days of ripening.
• Experimental trials Control cheese showed signs
  of CLC 90 days of ripening. Gas flushed
  packaged cheese showed CLCs 30 days of ripening.
  Vacuumed packaged cheese showed CLCs 60-65 days
  of ripening.

23
Results and Discussion

• Each cheese manufactured was screened for D and
  L-lactic acid, including in the different
  packaging conditions.
• Statistics ANOVA (Minitab 14)
• No significant difference of lactic acid content
  between A and A cheese (p0.711-0.970).
• Expected result since addition of CaCl2 was not
  expected to influence production of D(-)-lactic
  acid.
• When looking at D(-)-lactic acid content of C and
  A/A cheeses over ripening time, there is a
  significant difference (C p0.00, A p0.08, A
  p0.04).
• Expected to observe an increased amount of
  D(-)-lactic acid, but whether a significant
  increase was in question.
• There was no significant difference of
  L()-lactic acid content in C and A/A cheeses
  over ripening time.
• When looking at D(-)-lactic acid content on
  sampling days between C and A/A cheese, there is
  a significant difference.
• Type of packaging showed a significant difference
  on control cheese, however, no difference was
  observed with the A/A cheeses.

24
What does this mean?

• There seems to be a correlation of Lb. curvatus
  cell density to D(-)-lactic acid content.
• However, a direct enzyme activity wasnt done to
  confirm this.
• Observation Preliminary trial bacterial counts
  and lactic acid content compared to experimental
  trials.
• High correlation of D(-)-lactic acid to CLC
  development.
• Based on observation and lactic acid analyses.
• Packaging influences CLC development.

25
Polymerase Chain Reaction (PCR)

• PCR is a technique for amplifying the amount of a
  specific segment of DNA.
• First conceived by Kary Mullis in the 1980s by
  manipulating DNA polymerase, which received the
  Nobel Prize in Chemistry in 1993 along with
  Michael Smith for his contribution in
  oligonucleotide, site-directed mutagensis.
• Basic strategy of PCR
• Denaturation of template DNA
• Annealing of primers
• Extension of DNA
• For this project, needed to figure out the D-ldh
  gene for Lb. curvatus.
• Template DNA
• Primers
• PCR
• Did we get the gene?

26
PCR
27
PCR
28
PCR
29
Did we get the D-LDH gene?

• Yes and no. We believe we have a fragment of the
  gene.
• 2 fragments were obtained. LB2-5C12 and
  LB2-5C-10 (920bp and 1132bp, respectively)
• Clustal W to compare with published D-ldh genes.
  Fragment reside together and towards the middle
  of the published sequence.

gtLB25C10 ATCTGGCGTTTAACGAATCGCCCTTGTAGAAGCAGTGTGC
CCATTGGCTAACTTCTTCTTTTCGATGACGTATTCGTAAATTTTAGCGGC
ACTACGCGTGACCGTTTCTTGTGATAAGCGATCTTTGTTAGCTTGAATAA
ATGCTTGGACATCGGAATCGTTCAAGGCATCTTCGACCAATTTATTAAAC
TGTTGGTTTAACTTTTGCCGATTCATGTAATCCGTCAAATCTTTACCCAT
ATTTTCCATTACGATTCCCGCCCCTCACGAATTTTTTTCAATGCCGCTTC
TAGTTCATGCTGATGCTCAGGTGTGGTTGtTTCTTTTGGCGCTTGATAAT
CTGGTTTAGCCCATTTAGGTACTGGTTCTTTTTTAGTTTTGTTCTGATAA
CGCGTTTGGCGATTGTTTTGCACCTTTGCCGYCTGTTTGGTTTGGAAATC
GSGAATCTGCAAAATCGCATCCGCTGCCGTCTTAACCCCTTGTTGAGCCC
ATTGGTTCGCAATCCGATCGACTAGCGCCTGAGTGAGCCCATCATATTGC
GTAATGATATAAACGACCAAAATATTGAGCACATCATTGTTAAAGATATA
GCGGTTTTGCAAGTCCTTTAACGCCCGGATTTCATTTTTAGCGACAAAGC
CGTGGTTCTTTTGTTTCAAGTATTCGAGATAATCAACTGGCAAGTAGCCC
TGACTTTCTGTTAGCCACTGCAATTCCTGTTCGTTAAAGCCGGCTTTTTG
CCATTCTTTTTGKAACTCGGCTAACGGTTTTtGCGTTGTTGTAgCASCTG
GCGTTTGCCGGTtACTCTGACGTCSTGKGKAATTGKTCAAgACGTTCTGT
TCgAGCGCTGCCATATTAATCGTACTGTCAGCAACATTCATCGTCAAGCC
AATCAAACGCGCTAAGTCCATCTCATCTAGACCATAGAAATAATGGAGAT
TAAACAAGCCCTGTTCATTTTTGAGAATTTGATCCGTATCAATCTGGTAT
TGCGCCGTTGCATCTTGTAATAGGTCCCAATCAAAAGTCCGCAACTCAAC
CGAGGTAAACTGCGGTGTGCTAGCTGCTTTTTGTTGATACATTGCCTTAG
TTTCAGCCACACGCTTCTACAAGGGCGAATCGGGCGTATCAG
30
Conclusions

• Strong correlation between high bacterial density
  of Lb. curvatus and CLC formation.
• CO2 packaging seem to allow faster CLC formation
  versus vacuum packaging.
• Lb. curvatus produces the enzyme D-lactate
  dehydrogenase yielding D(-)-lactic acid.
• Correlation of D(-)-lactic acid content and CLC
  formation.

31
Recommendation for Future Work

• Produce a mutant Lb. curvatus with the D-LDH gene
  deleted or partially deleted.
• Complete sequence of Lb. curvatus genome and its
  D-LDH gene.
• Bacteriocins or cross-inhibition studies to Lb.
  curvatus and other D(-)-lactic acid producing
  bacteria.

32
Recognition

• Dr. Shakeel-Ur Rehman and Dr. Vedamuthu, E.
• Agriculture Research Initiative
• Staff and colleagues of the Dairy Products
  Technology Center
• Mr. and Mrs. Chong Nam Yim and family
• Jocelyn Fagar Rest in peace.

33
References

• Agarwal, S. C., S. Swanson, B.G. Yuksel, G.U.
  2003. Non starter lactic acid bacteria and
  calcium lactate crystal formation in Cheddar
  cheese. Institute of Food Technologists.
• Chou, Y. E. E., C.G. Luedecke, L.O. Bates,
  M.P. Clark, S. 2003. Nonstarter lactic acid
  bacteria and aging temperature affect calcium
  lactate crystallization in cheddar cheese.
  Journal of Dairy Science. 862516-2524.
• Coyne, V. E., M. D. James, S. J. Reid, and E. P.
  Rybicki. 2001. PCR Primer Design and Reaction
  Optimisation. Molecular Biology Techniques
  Manual. 31-11.
• Dorn, F. L. and A. C. Dahlberg. 1941.
  Identification of the White Particles Found on
  Ripened Cheddar Cheese. New York Agricultural
  Experiment Station.31-36.
• Dybing, S. T., J. A. Wiegand, S. A. Brudvig, E.
  A. Huang, and R. C. Chandan. 1988. Effect of
  Processing Variables on the Formation of Calcium
  Lactate Crystals on Cheddar Cheese. Journal of
  Dairy Science. 711701-1710.
• Johnson, M. E., B. A. Riesterer, C. Chen, B.
  Tricomi, and N. F. Olson. 1990. Effect of
  Packaging and Storage Conditions on Calcium
  Lactate Crystallization on the Surface of Cheddar
  Cheese. Journal of Dairy Science. 733033-3041.
• Kochhar, S., H. Hottinger, N. Chuard, P. G.
  Taylor, T. Atkinson, D. Scawen, and D. J.
  Nicholls. 1992b. Cloning and Overexpression of
  Lactobacillus helveticus D-Lactate Dehydrogenase
  Gene in Escherichia coli. European Journal of
  Biochemistry. 208799-805.
• Marshall, R. T. 1992. Standard Methods for the
  Examination of Dairy Products. 16th ed.
• Roux, K. H. 1995. Optimization and
  Troubleshooting in PCR. Cold Spring Harbor
  Laboratory. 4S185-S194.
• Severn, D. J., M. E. Johnson, and N. F. Olson.
  1986. Determination of Lactic Acid in Cheddar
  Cheese and Calcium Lactate Crystals. Journal of
  Dairy Science. 692027-2030.
• Templeton, N. A. 1992. The Polymerase Chain
  Reaction. Diagnostic Molecular Pathology.
  1(1)58-72.
• Thomas, T. D. and V. L. Crow. 1983. Mechanism of
  D(-)-Lactic Acid Formation in Cheddar Cheese. New
  Zealand Journal of Dairy Science and Technology.
  18131-141.