Title: Bioinformatics:%20SNPs
1Bioinformatics SNPs
2Genome Sequencing
3(No Transcript)
4Genetics
- Inherited contribution to phenotypic variation
5- Environmental factors
- Genetic factors
- independent determinants
- determinants which govern reaction to
environmental factors
6Genetics
- Genetic Identity
- Genetic Diversity
7Genomics and Biomedicine
- Medical conditions
- Diagnosis and Treatments
- Gene therapy
- Individualized drugs
8Human Genetic Variation
- Disease risk
- Drug response
Biological variation vs. DNA sequence variation
9Inherited contribution to risk of type II Diabetes
- Your neighbor (unrelated) 5-10
- Your sibling 30-40
- Your identical twin gt90
10Traditional Approach
- Linkage or recombinatorial mapping
- Successful for single gene disorders
- Little success for common complex traits, such as
heart disease, diabetes, asthma, mental disorders
11- The human genome sequence 3.2 billion bp
12- 99.9 identity - how many differences?
- O.1 of 3.200 Mb 3.2 Mb
- 3.200.000 SNPs (?)
- One SNP every 1,300 bases.
13- Human Genetic Variation
- SNPs-Single Nucleotide Polymorphisms
GATTTAGATCGCGATAGAG GATTTAGATCTCGATAGAG
14Pharmacogenomics
- The use of DNA sequence information to measure
and predict the reaction of individuals to drugs.
15Pharmacogenomics
- Personalized drugs
- Faster clinical trials through selected trial
populations - Less drug side effects
16Drug Responses
- Absorption
- Distribution
- Activation
- Metabolism
- Excretion
17- Genetic Factors
- Environmental Factors
18Patients
- Responders
- Non-responders
- Toxic responders
19Goals
- Right Drug
- Right Dose
- Right Patient
20 21Types of SNPs
- Causative SNPs
- coding SNPS
- non-coding SNPs
- Linked SNPs
- non-coding SNPs
22Raw Genome Data
23(No Transcript)
24To find SNPs in raw sequence ...
25Single Nucleotide Polymorphisms
- How many?
- What kind?
- How do we find them?
26GATTTAGATCGCGATAGAGGATTTAGATCTCGATAGAG
- Rare Alleles
- ---o--------------------
- -----o------------------
- -------o----------------
- -----------o------------
- ---------------o--------
- -------------------o----
- Many
- Common Alleles
- ----o-------------------
- ----o-------------------
- ----o-------------------
- --------------------o---
- --------------------o---
- --------------------o---
- Few
27Raw Genome Data
28Database mining
- Discover new SNPs
- Contig overlaps
- Comparison along entire sequence
- Comparing redundant EST sequences
- Validate SNPs
- Sequencing
- Microchips
29- gtgbBE588357.1BE588357 194087 BARC 5BOV Bos
taurus cDNA Length369 - Score 272 bits (137), Expect 4e-71
- Identities 258/297 (86), Gaps 1/297 (0)
- Strand Plus / Plus
- Query 17 aggatccaacgtcgctccagctgctcttgacgactccac
agataccccgaagccatggca
- Sbjct 1 aggatccaacgtcgctgcggctacccttaaccact-c
gcagaccccccgcagccatggcc - Query 77 agcaagggcttgcaggacctgaagcaacaggtggagggg
accgcccaggaagccgtgtca -
- Sbjct 60 agcaagggcttgcaggacctgaagaagcaagtggaggg
ggcggcccaggaagcggtgaca - Query137 gcggccggagcggcagctcagcaagtggtggaccaggcca
cagaggcggggcagaaagcc -
- Sbjct 120 tcggccggaacagcggttcagcaagtggtggatcaggcc
acagaagcagggcagaaagcc -
- Query 197 atggaccagctggccaagaccacccaggaaaccatcgac
aagactgctaaccaggcctct -
- Sbjct 180 atggaccaggttgccaagactacccaggaaaccatcga
ccagactgctaaccaggcctct
30SNPs in Overlapping Genomic Sequences
Overlapping BACs from library
50 of overlaps contain polymorphisms
31(No Transcript)
32(No Transcript)
33Validation
- Correlation between phenotype and SNP
- Recombinatorial linkage vs. SNP linkage
34GATTTAGATCGCGATAGAGGATTTAGATCTCGATAGAG
- Common Alleles
- ----o-------------------
- ----o-------------------
- ----o-------------------
- --------------------o---
- --------------------o---
- --------------------o---
- Few
- Rare Alleles
- ---o--------------------
- -----o------------------
- -------o----------------
- -----------o------------
- ---------------o--------
- -------------------o----
- Many
35Data from 24 individuals for the marker S gene
1118
36GATTTAGATCGCGATAGAGGATTTAGATCTCGATAGAG
- Responders
- ---o----o--------o----o------o----o--o-
- ---o----o--------o----o-----------o--o-
- ---o-o--o--------o----o-----------o--o-
- Non-responders
- --------o--------------------o----o--o-
- ----o---o--------------------o----o--o-
- --------o--------------------o----o--o-