DNA barcoding using the cytochrome c oxidase I (COI) gene will allow species identification within the genus Agrilus. This will allow the positive identification of not only Agrilus males but females, larvae, and eggs.

1
ATCCCGCTTTGATATCCGGCTTGAGTCGGTGTGTGCCAACGCGATATGAC
GGACGTGTGTGCGAGGGTCTCAACTACAGGGATTAGATAGATGATATTTT
AGATATTAGAGGAAAAGAGAGGGGAGCGACGAGGCGAGGGCGAGCTGTAG
CTACGGGATCATGCATGCGAAGGGATCGAGCTGACCCACACACCCGCGGC
GCGGCATATGCATCTCTCTCAGCGAGAGACATATATATACGATTTTTTAT
GAGAGTAGCAGGAGGCGAGGCCCCGAGCGCGAGATATATAAAATATAGAG
AATAGTATTTTTTAGATATACGCCGCGAGCGCGCGGCGCGCTATATATAT
ATTCTCGCTACGATGTAGCATCGATGCAGATGCGATTATATATATGATTA
TTGGCTAGCTATGCGCGGCGATGGAGACATATATATACGATTTTTTATGA
GAGTAGCAGGAGGCGAGGCCCCGAGCGCGAG
mtDNA Barcoding for Taxonomic Identification
within the Genus Agrilus John T. Shukle and
Jeffrey D. Holland Department of Entomology,
College of Agriculture, Purdue University, 901
West State Street, West Lafayette, IN 47907, USA
(4/04/07)
Introduction
Taxonomic Relationships
Sequence Variation
Ecological studies are constantly refining our
image of what an ecosystem is and how it works
however, these studies are often complicated and
time consuming due to several limiting factors,
one of which is the need for species level
identifications. Studies involving insects
especially rely on fast and accurate
identification. Unfortunately, many groups of
insects require a high level of expertise to
identify to the species level. Insects have a
major effect on natural ecosystems, either by
driving ecosystem services or as disruptive
invasive species. There is a clear need for a
faster method of species identification within
these important groups of organisms. The main
objectives of my research are 1. Test the
hypothesis that a standard DNA sequence can
differentiate species within the genus Agrilus,
and 2. Develop a searchable DNA barcode database
for the genus in the Midwest.
H. memnonius
Within Species
Between Species
A. fuscipennis
60
Occurrence
Occurrence
A. cephalicus
A. cyanescens
Concepts of Barcoding
Sequence Variation
Sequence Variation
61
DNA barcoding uses sequences of DNA to
identify species based on base pair comparisons.
While the concepts behind DNA barcoding should
work for most rapidly evolving genes,
mitochondrial genes have become the preferred
choice because of their
100
A. lacustris
Conclusions
58
maternal inheritance, low recombination
potential, and lack of insertions and deletions.
Within the mitochondrial genome the cytochrome c
oxidase I (COI) gene was chosen as a standard for
DNA barcoding because of the presence of robust
primer locations. One of the main advantages of
DNA barcoding is the ability to identify an
individual to species using very small amounts of
tissue, for example, a single insect leg or the
base of a birds feather. While initial studies
have proven the effectiveness of barcoding as a
tool for species identification, the validity of
the technique still needs to be tested at finer
resolutions. I chose to test this technique
within the genus Agrilus.
Mitochondrial DNA strands

• DNA barcoding using the cytochrome c oxidase I
  (COI) gene will allow species identification
  within the genus Agrilus. This will allow the
  positive identification of not only Agrilus males
  but females, larvae, and eggs.
• Availability of good quality specimens for
  initial DNA extraction seems to be a major
  limiting factor in studies of this kind. The
  ability to amplify DNA from archived specimens
  provides a large sample size to begin barcoding,
  along with demonstrating the value of
  collections.
• Future research will involve expanding the number
  of species within the database. Currently I
  have sequence data for 31 of the approximately 70
  species of Agrilus native to Indiana and the
  surrounding Midwest. Once complete, a DNA
  barcode database of native Agrilus species could
  be used to identify unknown samples or facilitate
  ecological studies.

A. celti

• While DNA barcoding is primarily a tool for
  species identification, barcode-based trees can
  provide a preliminary phylogenetic placement for
  species. The number of taxa (species) supported
  by a tree based on barcode sequence data is
  related to the number of determining characters
  within the sequence. Therefore, the longer the
  sequence the more taxa can be successfully
  placed.

A. cladrastis
60
Fig. 1. Mitochondria contain large numbers of
replicates of their circular genomes. This
provides an excellent amount of starting template
for PCR reactions.
A. planipennis
60
Fig. 6. Larva of A. bilineatus showing the
characteristic morphology for the genus
A. ferrisi
Biology of the Agrilus
41
A. bilineatus
The genus Agrilus is the largest genus within
the family Buprestidae, order Coleoptera, and
contains nearly 3,000 described species.
Agrilus
larvae are borers that feed on the living tissue
of their host. Most species attack the cambial
tissue of woody trees or shrubs, although a few
species do feed on herbaceous plants, generally
attacking root or stem tissue. In native
habitats Agrilus target stressed or dying host
plants, providing an ecosystem service by
eliminating diseased individuals of a population.
However, when introduced into ecosystems where
host plants lack co-evolutionary resistance, or
where natural predators and parasites are absent,
they can become severe pests. The recent
infestation of Emerald Ash Borer, Agrilus
planipennis, is an excellent example of this.
37
A. ruficollis
67
A. vittaticollis
B
A
Fig. 2. Galleries in oak caused by A. bilineatus.
High levels of infestation girdle the host
tree.
Summary
Fig. 4. Phylogram showing the taxonomic
relationships of 11 species of Agrilus based on
full (708 bp) and micro (369 bp) mtDNA barcodes.
For distance/neighbor-joining analysis 1000
bootstrap replicates were performed. The values
at nodes refer to the percentage of replications
supporting each node. The click beetle H.
memnonius was used as an outgroup.
Recent studies have shown the efficacy of
mtDNA barcoding to differentiate morphologically
similar species. I used a 708 bp fragment
internal in the cytochrome c oxidase I (COI) gene
to evaluate the effectiveness of this technique
within the genus Agrilus. Results indicate that
mtDNA barcoding using the COI gene will provide a
viable method to distinguish between species in
the genus.
Methods
LCOF 1490
Ag1718F
COI
708 bp Barcoding Region
DNA was extracted from three legs of
specimens collected on purple sticky traps or
from museum specimens, using either a Qiagen
DNeasy kit or a modified version of the method of
Lis et al. (1983). Some museum specimens were
more than forty years old. PCR reactions
followed the protocol described by Hebert et al.
(2002). Forward and reverse primers from Hebert
et al. (2002) were used to
5
3
1401
2942
Acknowledgements
Ag1859R
HCOR 2198
amplify the full 708 bp barcoding region. For
amplification from degraded DNA, degenerate
versions of primers from Simon et al. (1994) were
used to recover 369 bp and 480 bp overlapping
fragments internal to the barcoding region (Fig.
3). DNA was direct sequenced bi-directionally
through either MWG Biotech or the low throughput
genomics facility at Purdue. Pairwise sequence
comparisons were done in PAUP. The program
Clustal X was used for multiple sequence
alignments and to generate a neighbor-joined
tree. Overlapping fragments were merged using
the Merger tool in EMBOSS.
Barcoding Region
This work was supported through undergraduate
research scholarships from the Purdue College of
Agriculture. Additional financial support came
from the Department of Entomology. Specimens
and identification material were generously
provided by Arwin Provonsha.
1 Fresh
2 Dried
Gene Coding Regions
Forward Primer
1 Kb
1 Kb
A
A
Reverse Primer
B
B
C
C
References
tRNA Coding Regions
mtDNA Genome
Control Region
Hebert, Paul D. N, et al. 2002. Biological
identifications through DNA barcodes. Proc. R.
Soc. Lond. Online. Lis, J. T., et al. 1983. New
heat shock puffs and ß-galactosidase activity
from transformation of Drosophila with an
hsp70-lacZ hybrid gene. Cell 35403-410. Simon,
N., et al. 1994. Evolution, weighting, and
phylogenetic utility of mitochondrial gene
sequences and a compilation of conserved
polymerase chain reaction primers. Ann. Entomol.
Soc. Am. 87651-70.
Fig. 5. The order of genes on the mitochondrial
genome of Tribolium. The enlarged region shows
the position of the barcoding region within the
COI gene and positions of forward and reverse
primers. Indicates primers from Hebert et al.
(2002). Indicates degenerate versions of
primers from Simon et al. (1994).
Fig. 3. The success of PCR amplification depended
on the quality of the template DNA 1. Fresh
collected A. planipennis 2. Dried specimen of A.
bilineatus. Three sets of primers were used to
amplify either (A) the whole 708 bp barcoding
region, or two overlapping internal fragments of
(B) 480 bp and (C) 369 bp respectively.