ssss

1
Topic 2. Lectures 3-4 Evidence for Past
Evolution - Reasoning So, you are asked to
believe in the Weak Claim (anagenesis, profound
changes of ancestors of modern species) and in
the Strong Claim (cladogenesis, common ancestry
of modern species).
No one should accept such weird claims without
some good reasons.
2
Indeed, how did modern species come into being?
What is the truth a) no evolution, or b)
Weak Claim only, or c) both Weak and Strong
claims?
Three log tips, protruding from a muddy, swallen
river - what is below the surface?
3
Philosophical prologue I Can we have any
evidence for past evolution? We cannot directly
observe past events, let alone affect them by
experiments. So, are cosmology, geology,
evolutionary biology, or history sciences? Did
Napoleon Bonaparte or Ronald Reagan really exist?
Because this last question is stupid, there must
be some ways to study past.
4
To study past, we must First, believe that the
Universe is not entirely chaotic, or free to do
whatever it wishes. Instead, there are laws of
nature, restrictions on what could
happen. Second, believe in "Uniformitarianism",
a premise that in the past laws of nature were
more or less the same as today. If so, "present
is the key to past". If we accept these two
postulates, we are in business. For example, a
thing we call "T. rex skeleton" must really be
a remnant of a huge beast - it could not be
produced abiogenically. Analogously, we must
conclude that countless evidence for existence of
Napoleon Bonaparte could not all be faked in one
global conspiracy. Why "historical
revisionism", applied both to history of life and
of humanity, attracts so many people, is an
interesting question which we will ignore.
5
Evidence for past objects and events (and
persons) can be of 3 general kinds 1) Direct
messages from the past - if, at some moment, an
object "froze" and stopped changing, it can give
us a direct window into the past.
A message from the past Tyrannosaurus rex
skeleton. Such structures do not naturally
condense from clay these days, and
Uniformitarianism implies that this was never
possible. Thus, a T. rex skeleton tells us a lot
about a living being that lived in the past. Of
course, a T. rex skeleton is not in itself an
evidence for past evolution.
6
Another message from the past Nag Hammadi library
In 1945, twelve papyrus codices buried in a
sealed jar were found near Nag Hammadi by a
peasant named Mohammed Ali. The codices include
Gospel of Thomas and are believed to be a library
hidden by monks from the nearby monastery of St.
Pachomius around year 390.
7
2) Sometimes, we know laws of changes precisely
and can "play time back". For example, knowing
concentrations of 40K (P - parent) and 40Ar (D -
daughter) isotopes within a crystal, we can play
back the dynamics of radioactive decay of 40K
into 40Ar (because the decay constant, l, can be
measured today) and, thus, calculate the age of
the crystal t
In particular, if the number of radioactive
parent atoms is equal to the number of stable
daughter atoms, the age of the crystal is t
years, where t is half-decay time. Of course,
life is too complex and too stochastic for this
approach.
8
3) In more complex cases, we have to resort to
"hypothetico-deductive" method i) observe
something, ii) try to imagine all possible
scenarios of how this something could appear,
iii) compare their implications to what you see.
Application of the hypothetico-deductive method
by our ancestors these footprints were left by
a mammoth!
9
A more complex application of the
hypothetico-deductive method there is now a
general agreement that big craters on Mars, Moon,
and Earth (and in many other places) were left
by impacts of celestial bodies.
10
The same hypothetico-deductive method is the only
way to learn something about the core of the
Earth.
The very boundary between past and present can be
blurred tonight, we observe a ten billion
years-old galaxy.
Thus, we can study the past without making any
apologies.
11
Philosophical prologue II Do we need any
evidence for past evolution? Evolution is the
only feasible natural explanation for the very
existence of modern life. Can we reject
supernatural alternatives to evolution without
consideration and, thus, accept past natural
evolution "by default"? Indeed, in natural
sciences, as well as in criminal justice, the
existence of a natural explanation for any
phenomenon is always accepted as null hypothesis.
The birth of Aphrodite from sea waves - the only
alternative to evolution
A hopeless criminal defense.
12
When DNA evidence exonerates a person, found
guilty "beyond reasonable doubt", after a "fair
trial", this innocent person is released, without
any opposition.
Kirk Noble Bloodsworth, the first U.S. death row
prisoner exonerated by DNA, in 1993.
Occam's razor use only the minimal set of
fundamental principles to explain your facts, and
do not invoke unnecessary principles.
13
However, the case of past evolution of life is
more difficult. Indeed, we know that a mismatch
between DNA from the crime scene and from a
convicted person can appear naturally, if the
conviction was wrong. In contrast, we are not
sure a priori that evolutionary origin of modern
life is possible.
Remember - "To suppose that the eye ... could
have been formed by natural selection, seems, I
freely confess, absurd in the highest possible
degree" (Darwin). Thus, it is prudent not to
accept past natural evolution by default, but to
seek evidence for - or against - it.
14
Here we encounter another unusual situation
normally, natural sciences compare alternative
hypotheses.
Geocentric or Heliocentric?
However, there is no natural alternative to
evolution - and natural sciences do not tell us
what to expect from supernatural origin of
life. Thus, the only thing we could really do is
to compare implications of a hypothesis of past
natural evolution to the data. So, what we do
and do not expect to see if modern life is a
product of past evolution?
15
Direct and Indirect evidence for past
evolution Direct evidence is provided by fossils
- messages from the past. Indirect evidence are
provided by features of modern organisms - after
application of the hypothetico-deductive
method. Direct and indirect evidence complement
each other nicely. Fossils inform us about 1)
some morphological traits of past organisms - but
usually not about their colorations or
genotypes. 2) existence of organisms that left no
living descendants, such as mammoths or
Paranthropus. Modern organisms inform us
about 1) genomes of their ancestors. 2)
branching order in the Tree of Life. Indirect
evidence for past evolution stem from
transmission of genetic information from parents
to offsping, a processs unique to life. I prefer
to start from indirect evidence, because
considering them is the best way to introduce
evolutionary thinking. So, for now we will ignore
fossils.
16
Indirect evidence for past evolution Connectednes
s and designability of modern species great
indirect evidence we do not have. Indeed, if
modern species are products of evolution from one
common ancestor (LUCA, last unvesral common
ancestor), they all must be connected in the
space of genotypes, by continous series of fit
genotype. Also, each species must be connected by
such a series to something VERY SIMPLE. Touble
is, we do not know if this is the case.
So, we have to seek less ambitious evidence,
based only on "local" properties of modern
species. Let us start from a paradox and two
examples.
17
Paradox perfect adaptations of modern organisms
are not evidence of past evolution of their
ancestral lineages. Darwin proposed that
adaptations are the result of evolution driven by
natural selection. Thus, one may think that
perfect adaptations of modern species are the
best indirect evidence for Darwinian evolution of
their ancestors. NO!
Bodies of sharks are very close to perfection.
A perfect adaptation of a modern organism does
not give us any reason to think that its
ancestors were different from it - thus, no
evidence for evolution emerges.
18
Instead, past evolution is evident primarily from
those features of modern organisms that do not
contribute to their fitness. Examples
1) A real evidence for past evolution suboptimal
phenotype of a modern species. Blind cave fish
Astyanax mexicanus with vestigial, useless eyes.
19
H.s. cagctcaccatggatgatgatatcaccgcgctcgtcattgacaac
ggctc
P.t. cagctcaccatggatgatgatatcaccgcgctc
gtcatcgacaacggctc H.s. cggcatgtgcaaggccagcttcacgg
gcgacaatgccgcccgggcagtct
P.t.
cggcatgtgcaaggccggcttcacgggcgacgatgccacccgggcagtct
H.s. tcccctccatcgttgggcaccccaggcaccagggcgtgatggt
gggcatg
P.t. tcccctccattgttgggcaccccaggcacca
gggcgtgatggtgggcatg H.s. ggtcagaaggattcctatgtgggc
gacgaggcccagagcaagagaggcat

P.t. ggtcagaaggattcctatgtgggcgacgaggcccagagcaagag
aggcat
2) A real evidence for past evolution similarity
between different modern species not forced by
similarity of their adaptations. Partial
alignment of human (Homo sapiens) and chimpanzee
(Pan troglodytes) useless genome segments called
beta actin processed pseudogenes. The two
pseudogenes are 98.8 identical and are flanked
by the same genes.
20
So, why does evidence for evolution emerge from
bad, or at least harmless but useless, phenotypes
- and not from perfect adaptations? Because we
have no natural alternative to evolution. Thus,
no evidence for evolution may emerge from what
evolution CAN do, but its alternative (absent!)
CANNOT. Instead, evidence for evolution primarily
emerge from what evolution CANNOT do.
Fortunately, evolution is very far from being
omnipotent. Slow, gradual evolution (if it
occurred!) CANNOT always produce optimal
phenotypes, and CANNOT completely erase traces of
history from evolving phenotypes. Thus, we
expect evolution to produce suboptimal phenotypes
and useless similarities between phenotypes (and
some other useless patterns) - and if reality
matches these expectations, we have indirect
evidence for past evolution. In other words, as
far as evidence for past evolution is concerned,
slow, gradual nature of evolution - the only
natural possibility - is more important than its
mechanism, natural selection that increases
adaptation. Darwin was fully aware of paradox.
Evolution naturally leads to suboptimality
(purple) if 1) a lineage is still climbing or 2)
a lineage is trapped on a low peak. Evolution
naturally leads to unforsed similarity or
homology (shades of green) if multiple lineages
are all initially located in the domain of
attraction of the same peak.
21
Fortunately, we often can say something, with
reasonable confidence, about fitnesses of
currently existing species, and this may be
enough. 3 degrees of optimality of a phenotype
Suboptimal (a), non-uniquely optimal (b), and
uniquely optimal (c) phenotypes.
22
1. Slow, gradual, and greedy evolution must be
prone to produce species with suboptimal
phenotypes. Thus, when we see suboptimality in a
modern species, this is evidence of Weak Claim
for it. 2. Slow, gradual, and greedy evolution
must be prone to retaining similar non-uniquely
optimal (or even suboptimal) phenotypes in all
species which originated from the common
ancestor. Thus, when we see similar non-uniquely
optimal (or even suboptimal) phenotypes in
several modern species, this is evidence for
Strong Claim for them. H.s. cagctcaccatggatgatga
tatcaccgcgctcgtcattgacaacggctc

P.t. cagctcaccatggatgatgatatcaccgcgct
cgtcatcgacaacggctc Unforced similarity
(similarity too deep to be explained by common
adaptations) is called homology. In particular,
all similarities of functionless features, such
as junk DNA, are homologous.
23
In contrast, no evidence for evolution emerges
from unique optimality - in one or even in many
species.
Shared optimal body shape of sharks, ichtyosaurs,
and dolphins - or shared optimal hexagonal
honey-combs of diffrent bees and wasps - do not
imply that their ancestors were different, or
that they shared a common ancestor.
24
In addition to 1) suboptimality and 2)
homology, indirect evidence for past evolution
can emerge from 3) hierarchical distributions
of trait states, 4) patterns in ranges of modern
species not explainable by their adaptations, 5)
agreement between what we see and some simple
evolutionary scenario, 6) agreement between what
we see and a partial theory of Macroevolution. L
et us analyze these 6 possible kinds of evidence
in some detail.
25
1) Suboptimality
Suboptimality can be of two kinds

easy-to-improve, if given more time
hard-to-improve - trapped on a low peak
To imply past evolution, a suboptimality must be
unconditional a polar bear suffering from heat
in a zoo is not an evidence for evolution.
26
Vestigial eyes probably are an easy-to-improve
suboptimality some cave animals do not have any
eyes.
Contorted morphology of adult flatfishes is a
suboptimal, and perhaps hard-to-improve,
adaptation to bottom-dwelling. Young flatfishes,
which are pelagic, have bilateral symmetry.

Stingrays, which adapted to bottom-dwelling
differently, are always bilateral.
27
2) Unforced similarity, or homology
"Simia quam similis turpissima bestia nobis" (The
monkey, how similar that most ugly beast is to
us!). Quintus Ennius
(239169 BCE)
However, evolution has really been discovered
only 2000 years later - why? Because, similarity
between human and chimpanzee eyes, or between
genes, does not necessary provide any evidence
for our common ancestry. In contrast,
similarity between human and chimpanzee
PSEUDOgenes is an evidence for our common
ancestry, because it is obviously unforced.
28
Even similarity between functional phenotypes can
be homologous, if we believe that the same
function can be performed in many different
ways. Homologous phenotypes can also be
analogous, that is, perform the same function.
To claim homology, we must show that there are
many other ways of performing this function.
Two enzymes of totally different overall
structures that perform exactly the same function
- they both are inorganic pyrophosphatases - only
their active centers are (necessarily) similar.
29
Still, we may have a stronger case for homology
if similar phenotypes are not analogous, i. e.
perform different functions.
Limbs of vertebrates are only partially
analogous, and similarity of their functions can
hardly explain similarity in arrangements of
bones inside them.
30
Two kinds non-unique optimality
H.s. cagctcaccatggatgatgatatcaccgcgctcgtcattgacaac
ggctc
P.t. cagctcaccatggatgatgatatcaccgcgctc
gtcatcgacaacggctc
Continuous set of "optimal" phenotypes - junk
sequences
Isolated "optimal" phenotypes
In both cases, possession of the same phenotype
by many species is evidence for Strong Claim for
them.
31
Shared suboptimality is also a homology
Three species from over 400 flatfishes (order
Pleuronectiformes) Pleuronectes platessa (left),
Psetta maxima (center),Citharichthys sordidus
(right).
32
Homology is pervasive not only between species,
but also between different parts of the same
genotype or phenotype.
cagctcaccatggatgatgatatcaccgcgctcgtcatt
gacaacggctc
cagctcaccatggatgatg
atatcgccgcgctcgtcgtcgacaacggctc
cggcatgtgcaaggccagcttcacgggcgacaatgccgcccgggcagtct

cggcatgtgcaaggccggcttcgcgggcgacg
atgccccccgggccgtct tcccctccatcgttgggcaccccag
gcaccag------------------
tcccctccatcgtggggcgccccaggcacca
ggtaggggagctggctggg ------------------------
--------------------------
tggggcagccccgggagcgggcgggaggcaagggcgctttctctgcacag
-------------------------------------------
------- gagcctcccggtttccggggtgggggctgcgc
ccgtgctcagggcttctt ----------------ggcgtgatg
gtgggcatgggtcagaaggattcct

gtcctttccttcccagggcgtgatggtgggcatgggtcagaaggattcct
atgtgggcgacgaggcccagagcaagagaggcat

atgtgggcgacgaggcccagagcaagagaggcat
A fragment of human beta actin processed
pseudogene (top), aligned with the corresponding
region of human beta actin gene (bottom). The
pseudogene misses all introns (one of them is
shown in green), indicating its origin through
insertion of the DNA sequence produced by reverse
transcription of mature mRNA.
33
Homology of different parts of the genome - such
as alpha- and beta-hemoglobin genes, or a gene
and the corresponding pseudogene(s) is an
evidence for their common ancestry, and, thus,
for the Weak Claim for the whole species. In
contrast, homology of parts of the phenotype at
the above-genome level does not immediately
produce any evidence for past evolution. Why such
a contrast?
Parts of the genome are transmitted from
generation to generation, and their homology
suggests common ancestry. In contrast,
above-sequence phenotypes develop every
generation, and there is no common ancestry of
legs and arms. Homology is the most important
and pervasive kind of indirect evidence for past
evolution. Still, this is not the end of the
story - but enough for today.
34
Quiz Explain, in terms of fitness landscapes,
why one can expect slow, greedy evolution to lead
to suboptimal phenotypes and to preserve
homologies. Hints 1) Before you start
answering, make sure you understand this
difficult question, 2) Discuss you possible
answer with your peers, 3) Seek advice if needed!
35
3) Hierarchical distributions of trait
states Let us now move beyond homology, and
consider only traits that are not invariant
within a set of modern species. A joint
distribution of such traits can be an evidence
for the Strong Claim for the set, if this
distribution is hierarchical. This idea, like
most of what is covered in this lecture, goes
back to Darwin. Let us explain what is a
hierarchical distribution. This is the most
difficult part of the story of indirect evidence
for past evolution. Informally, multiple traits
are distributed hierarchically, if some states of
one trait only occur together with some states of
other traits.
Among vertebrates, placenta is "nested" within
bearing live young. Among insects, complete
metamorphosis is nested within having wings.
36

A more complex example of a joint distribution of
many variable traits
Traits Traits Traits Traits Traits Traits Traits Traits Traits
Species 7 9 12 33 34 42 57 79 116
Homo sapiens E K V L V F G L A
Monodelphis domestica E K I L V F G L G
Gallus gallus E K I L I F G L A
Rana catesbeiana E K I F I Y G L G
Hynobius retardatus E K I L I Y A L A
Salmo salar A K I L I Y G M A
Danio rerio A R I L I Y G M A
A matrix of traits presenting phenotypes of 7
species each consisting of 9 traits. Each trait
characterizes a position in the alignment of beta
globins, and the trait state is the amino acid
that occupies this position. Only binary traits,
with just two states within the set of species,
were chosen. The species are human, gray
short-tailed opossum, chicken, North American
bullfrog, Hokkaido salamander, Atlantic salmon,
and zebrafish.
37
Venn diagram for the same data. For each trait,
species with the trait state which was shown in
red in the previous picture are enclosed by the
colored line. The joint distribution would be
hierarchical, if not two conflicts, between
traits 116 and 34, and between traits 116 and 42.
In both these pairs of traits, all 4 possible
combinations of their states are present. All
other pairs of traits are "nested".
38
Now, we are ready for a more formal treatment
Definition 1 Two binary traits, each with states
0 and 1, are said to be in conflict, within a set
of species, if and only if each of the 4 possible
combinations (00, 01, 10, and 11) of the trait
states is present in at least one
species. Definition 2 A joint distribution of
two or more binary traits is called hierarchical
if and only if in each pair of these traits there
is not in conflict, i. e. no more than 3
combinations of states of the two traits are
present within the set of species.
39
Two "poor" hierarchies (really the
same). Four "rich" hierarchies (really the
same). The only possible conflict.
40
OK, but why do we care about hierarchical
distributions of traits? Because we expect
evolution, if it occurred, to produce
hierarchical distributions of traits within a set
of species which evolved from the common
ancestor. Let us call (hypothetical) evolution
divergent, if every evolutionary event (a change
of the state of a trait) produces a new trait
state, never present before in any other lineage
derived from the common ancestor. All
similarities between the species produced by
divergent evolution must be inherited from their
common ancestor. If evolution was sufficiently
slow, we can expect it to also be divergent.
41
Theorem divergent evolution of a set of species
from the common ancestor can only lead to a
hierarchal distribution of binary traits within
the set. This is the so-called Pairwise
Compatibility Theorem, which is intuitively
obvious and can be easily proven. Try to invent
a course of exclusively divergent evolution from
a common ancestor that would lead to a conflict
between two binary traits - this will not work,
but can hint at the idea for a formal proof.
We must assume that the same event happened
twice, in order to obtain a conflict!
42
In contrast, any hierarchical, conflictless
distribution of traits can be obtained after
divergent evolution from a common
ancestor. For example
Origin of a poor hierarchy, 01 and 10
Origin of a rich hierarchy, 00, 10, and 11
43
3 feasible modes of non-divergent evolution
Reversal (left), parallel (center), and
convergent (right) evolution. The common ancestor
of the 4 species always had state A of the only
trait under consideration. Evolutionary events
are shown as short horizontal lines on the
phylogenetic trees. Collectively, independent
origins of the same trait state is known as
homoplasy. This figure only illustrates these
concepts - we do not address the issue of how we
know that the set of 4 species originated from
the common ancestor or how their exact phylogeny
was ascertained. Obviously, convergence is
impossible for a binary trait, and requires at
least 3 possible states.
44
Thus, a hierarchical distribution of multiple
variable traits within a set of modern species
provides indirect evidence for their common
ancestry because this is what we EXPECT to see
after divergent evolution. Of course, we do not
always observe heirarchical distributions, and do
not expect evolution to be exclusively
diveregent. In particular, a lot of conflicts is
observed at the level of nucleotide sites, which
is not surprising, because there are only 4
nucleotides (A, T, G, C), and homoplasy must be
common, if evolution occurred. Moreover, to be
an evidence for past evolution, a hierarchical
distribution must not be forced by low fitness of
absent combinations of traits.
Not an evidence for evolution.
Evidence for evolution.
In addition to providing evidence for past
evolution, hierarchical distributions are also
essential for reconstructing the course of past
evolution. Thus, we will revisit them soon, when
phylogenetic trees will be considered.
45
4) Patterns in ranges of modern species, not
explainable by their adaptations
This is another kind of evidence for past
evolution. Here, the Darwin's treatment is
sufficient ("Origin of Species", Chapter
11) In considering the distribution of organic
beings over the face of the globe, the first
great fact which strikes us is, that neither the
similarity nor the dissimilarity of the
inhabitants of various regions can be accounted
for by their climatal and other physical
conditions. A second great fact which strikes us
in our general review is, that barriers of any
kind, or obstacles to free migration, are related
in a close and important manner to the
differences between the productions of various
regions. A third great fact, partly included in
the foregoing statements, is the affinity of the
productions of the same continent or sea, though
the species themselves are distinct at different
points and stations. Summary similarity of
species from two points in space depends not on
how similar are the two environments, but on how
easy it is to migrate between them. These
patterns are evidence for past evolution, because
this is what one can expect as a result of local,
divergent evolution, with limited dispersal. Of
course, these patterns are to some extent related
to what we considered before.


46
The simplest geographical pattern which implies
evolution is unforced similarity (homology) of
ranges of similar species (Darwin's great fact
1). Example absence of placentals in Australia
(until very recently).
When introduced by humans, many placental mammals
are doing very well in Australia - thus, the
place is not inherently "placental-unfriendly". S
hared absence of placental in Australia, not
forced by their low fitness there, is evidence of
their evolution from a common ancestor outside
Australia.
47
Shared presence of Marsupials in Australia is
also consistent with an evolutionary scenario of
their origin, from the common ancestor, in
Australia.
48
External similarity between placental mole, and
"marsupial mole" is not an evidence for evolution
- one has to be a "mole" to live underground. In
contrast, similarity between placental mole and
camel (both have placenta and a lot of other
traits, defining them as placentals), together
with their shared absence in Australia, is
evidence for their common ancestry. Suboptimality
of the range of just one species, although
consistent with its localized origin, does not
directly suggest past evolution of its ancestors.
49
5) Agreement between what we see and a simple
evolutionary scenario Let us move beyond the
basic notion that past evolution, if any, was
slow and gradual, with limited dispersal. When
what we observe can be easily explained by a
simple scenario that involves evolution, we have
a scenario-based evidence for past
evolution. Example ancient whole-genome
duplication (autopolyploidization).
We know that WGD can happen, as there are very
many polyploids, such as Sequoia
sempervirens (probably, a hexaploid of AAAABB
type). What can we expect if a WGD occurred
long time ago?
50
A scenario of evolution following whole-genome
duplication (WGD). The box at the top shows a
hypothetical genome region containing ten genes
numbered 1-10. After WGD, the whole region is
briefly present in two copies. However, many
genes subsequently return to single-copy state.
In this example, only genes 1, 6 and 10 remain
duplicated. So, when we see something like the
bottom box, we have a scenario-based evidence for
evolution.
51
6) Agreement between what we see and a partial
theory of Macroevolution If biology were a more
advanced science, most of evidence for past
evolution would be of this kind. However, we have
only incomplete and fragmented theory of
Macroevolution, so our ability to expect
something specific (beyond simple scenarios) is
rather limited. Still, we DO already have some
useful theories. Example Neutral theory of
sequence evolution predicts that, within a
functionless segment of DNA, changes of different
kinds accumulate at the rates proportional to the
corresponding mutation rates.
nonCpG transversions CpG transitions CpG transversions indels
Rates of human mutations, observed in patients these days 0.53 15.4 1.5 0.10
Levels of human-chimpanzee divergence of pseudogenes 0.46 13.3 3.7 0.19
A good agreement between patterns in human
mutation and in human-chimpanzee divergence of
junk DNA provides theory-based evidence for
Strong Claim for these species. All numbers are
relative to nonCpG transitions.
52
The final question How do we recognize
indirect evidence for evolution in
nature? Natural phenotypes, unfortunately, do
not come together with nice pictures of fitness
landscapes. Indeed, poor understanding of
function and adaptation is the Achillean heel of
any indirect evidence for evolution. In
particular, it is hard to be 100 sure that a
phenotype is suboptimal. Perhaps, the most
uncontroversial evidence are based on shared junk
DNA - we believe that we understand genomes will
enough to claim that (most of) what we regard as
junk is, indeed, junk. We will address this
issue when specific examples will be considered.
53
So, we introduced indirect evidence for past
evolution of these 6 kinds 1) suboptimality of
the phenotype of one or many modern species, 2)
homology, or unforced similarity, between
different modern species, or between parts of
their genomes, 3) (unforced) hierarchical
distributions of states of variable traits within
sets of modern species, 4) patterns in
geographical distributions of modern species, not
explainable by their adaptations, 5) agreement
between what we see and a simple evolutionary
scenario, 6) agreement between what we see and a
partial theory of Macroevolution. Next time, we
will consider examples of such evidence.
54
Quiz What are hierarchical distributions of
traits and why are they viewed as indirect
evidence for common ancestry? Present your own
example of a hierarchical distribution. Seek
advice if necessary - this is not an easy
question!