Title: Finding Motifs in Promoter Regions
1Finding Motifs in Promoter Regions
2Overview
- Introduction and Definitions
- P-value Algorithm
- Experimental Results
- Generalizations and future work
3Transcriptional Regulationin the cell
4Motif Representation
- We need to represent the motif the TF binding
site. - There are three known representations
- Consensus Most frequent letter in every
position - IUPAC code Allow all letters with frequency
above a threshold in every position - Position Specific Weight Matrix Count number
of occurrences of every letter in every position
- More Informative ! -
Known binding sites
5An Example
- An alignment of 5 known binding sites of a TF
-
- Position Specific Weight Matrix - F
-
A 0 1 0 0 0 3
C 1 0 0 3 4 1
T 1 4 5 2 0 1
G 3 0 0 0 1 0
6Giving a Score to a Potential Binding Site
- We are given a site R(r1,..., rL). We want to
know how likely it is to be bound by the TF. We
compute how well it fits to the weight matrix of
the TF.
- We do this by calculating the Likelihood function
of the site namely, the probability that it
would have been generated given that it is indeed
a binding site of this TF.
7A 0 1 0 0 0 3
C 1 0 0 3 4 1
T 1 4 5 2 0 1
G 3 0 0 0 1 0
F
- Likelihood(GATTCC) (3/5)(1/5)(5/5)(2/5)(4/
5)(1/5) 0.00768
8The Score
- By taking log on the likelihood of R we get the
score of R, which is the Loglikelihood of R.
- Likelihood(GATTCC)
- (3/5)(1/5)(5/5)(2/5)(4/5)(1/5) 0.00768
- score(GATTCC) Loglikelihood(GATTCC)
- log(3/5)log(1/5)log(5/5)log(2/5)log(4/5)log(
1/5) -4.869
9The PSSM
- From the weight matrix F, we compute a Position
Specific Score Matrix (PSSM) M by
A 0 1 0 0 0 3
C 1 0 0 3 4 1
T 1 4 5 2 0 1
G 3 0 0 0 1 0
F
- For example, MG,1 log(3/5)
10Finding The Motif
- We are given a TF and a gene. We want to know if
this gene is regulated by the TF. - Our Input
- The sequence of the promoter region of the gene
- The PSSM of the TF
- A simple Algorithm Scan the promoter region,
and at each position calculate the score
according to the PSSM. Take the best position
(i.e. the one with the highest score) to be the
suspected binding site.
Max Score
-2.3
-4.5
-1.2
-5.2
-0.5
AAGTTGCCGAGATCGTAGCTATCGATCGATCGACAGCTAAC
11The Problem
Problem In any (e.g. random) sequence we will
find some best position (and best score). How do
we assign statistical significance (p-value) to
the position and score we have found.
Max Score
-2.3
-4.5
-1.2
-5.2
-0.5
AAGTTGCCGAGATCGTAGCTATCGATCGATCGACAGCTAAC
The Goal of Our Work
Statistical Evaluation
p value
12Overview
- Introduction and Definitions
- P-value Algorithm
- Experimental Results
- Generalizations and future work
13What Do We Want To Calculate?
- Let N be the promoter length, and L the length of
the TF binding site. Suppose we scanned the
promoter and have found that the maximal score
had the value t. - The p value is the probability that the maximal
score in a random sequence of length N, will be
above the threshold t.
14The Algorithm has two Steps
- 1. Finding the set of all the sequences of
length L, with a score above the threshold t. - 2. Calculate the probability of finding at least
one of those sequences in a random sequence of
length N.
15Step One Finding the sequences
- Let K K(t) be the number of sequences of length
L (out of the 4L) with a score above t. - We have a branch and bound algorithm for
enumerating them in time linear in K. - Problem In some cases K might be too large. For
example, Suppose L20, and only one of a thousand
sequences of length L has a score higher than t.
It means K420/1000 415 1billion. -
16 Approximating K
- If K is too large we cannot enumerate all the K
sequences, but only try to estimate their number
(i.e. K). - There are various methods to do so (Gaussian
approximation, Statistical Mechanics, Large
Deviations techniques). We used Generating
Functions method, which proved to be the best. - The method can give both lower and upper bounds
on the correct number K.
17(No Transcript)
18Two Steps
- 1. Finding the set of all the sequences of
length L, with score above the threshold t. -
- 2. Calculate the probability of finding at least
one of those sequences in a random sequence of
length N.
19Step Two Calculating Probabilities
- We are given a set of K sequences. We need to
calculate the probability of finding at least one
of them in a random sequence of length N. - First, lets consider a simpler problem, where we
have one target R (K 1).
20- Define H Number of occurrences of R in a
promoter region of length N. - R
- Our p value is P(H gt 0) 1 P(H 0)
AACG
AAACGGTTGTTACAACGGTTCCTCCAACG
H 3
21A Naive Approximation
- At a specific position, the probability of R
appearing is 1/4L, and the probability of R not
appearing is (1 1/4L ) - A naive approximation
- We have N-L1 possible start positions, so
- P(H 0) (1 1/4L )N-L1
- Problem We have neglected correlations !
22Why Do Correlations Matter ?
ATAA
TAAA
AAAA
AAAC
CTAA
TAAC
CAAA
AAAG
TAA
AAA
GTAA
TAAG
GAAA
AAAT
TTAA
TAAT
TAAA
TAA appears in 8 sequences of length 4 P(H gt 0)
8/44
AAA appears in 7 sequences of length 4 P(H gt 0)
7/44
The Difference is in the self-overlapping pattern
of them TAA TAA
AAA AAA TAA
TAA AAA AAA
No Self overlaps
Maximal number of self overlaps
Less self overlaps Higher
P(Hgt0)
23The effect of self overlaps
- The Mean of H Is E(H) (N-L1) (1/4L)
- Independent of the specific sequence R.
24The effect of self overlaps
- The correlation between close Xis
- depends on the specific sequence R.
R1
R2
- Less self overlaps Higher P(Hgt0)
25Algorithm
- We have developed a recursive algorithm which
takes into account the correlations. It
calculates the exact value of P(H gt 0). - In the more interesting case, where we have a set
of K target sequences, our method still applies. - If we assume that the promoters DNA is not
random but there are different probabilities for
A,T,C,G, the same algorithm still works. - Time Complexity O(N K log K)
26Algorithm (Cont.)
- When K is too large, we dont know the exact
sequences, but only (an approximation of) their
number.
- What we do Take the worst-case scenario (i.e.
highest P(H gt 0) possible)
- Highest p value fewest overlaps. We assume no
overlaps at all.
27Algorithm (Cont.)
- The case of no overlaps is possible for K lt 4L/L.
- We are usually interested in much smaller values
of K. Thus, for our case of interest, the bound
we get is quite tight.
- Upper Bound
- on P(Hgt0) -the P value!
- Upper Bound on K
- Lower Bound on Overlaps
28Gene's Promoter Regions
Sketch Of The System
Scan to get Max Scores
Transcription Factors Weight Matrices
Input
Estimate K (For each pair!!)
Small
Large
Enumerate K sequences
Bound pvalue
FDR
Calculate pvalue
p values
Statistical Evaluation
Statisticaly Significant Motifs
Output
29Overview
- Introduction and Definitions
- P-value Algorithm
- Experimental Results
- Generalizations and future work
30A Comparison with Matinspector
- We used the Promoter Database of Saccharomyces
cerevisiae. It contains genes and for every gene
the TFs that are known to bind its promoter. We
took 24 Transcription Factors whose PSWM is
known, and 135 promoters of genes which are known
to be bound by at least one of them. - Our Results
- We calculated the p-value (using the algorithm)
for each of the TFs on each of the genes.
31Our Results
- Each gene has 25 p-values of all the TFs. We used
the FDR method to find the statistical
significant TFs for every gene.
- Here the threshold for the FDR is 0.1, but we
will check the results for a range of threshold
values
32Our Results
- After we found statistical significant TFs for
every gene, we compared the results with the data
from the database. There are 2 parameters - False positives rate TFs that we found as
statistical significant, but are not known to be
bound to the gene. - False negatives rate TFs that are known to be
bound, but we didnt find. - Lower parameters values better
results
33Our Results Graph
- We calculated the average of these 2 parameters
(False positives rate, false negatives rate) on
all the genes, For a range of FDR threshold
parameter values, Q 0.01,,0.45
- Notice that the false positives rate is very
close to the FDR threshold value
34Matinspector Results
- For every gene Matinspector gives the number of
occurrences of every TF in its promoter, and an
estimation of the expected number of occurrences
(re value). - To compare to our results, we decided to declare
a TF as significant if it was found more times
than it is expected to be found, or, in other
words, if the ratio - (expected number)/(number of occurrences) is
lower than a certain threshold.
35Results Graphs
Matinspector Results
In our results the average of the 2 parameters
(green) is always lower, And the false positives
rate (red) is always much lower
36Comparison with Synthetic Data
Synthetic - All positives
are annotated
The left graph shows lower error rates then in
our true data. The right graph shows error rates
similar to those in our data, thus suggesting an
estimate for the amount of missing real binding
sites in the database.
37Overview
- Introduction and Definitions
- P-value Algorithm
- Experimental Results
- Generalizations and future work
38Markov Models
- In true DNA sequences, the nucleotides are not
independent but rather posses statistical
dependencies at close distances. - To model this, we used a markov model, in which
the distribution of each letter depends on some m
previous ones. m is denoted as the size of the
model. - Example Each letter depends on its previous
1st\2nd A C T G
A 0.37 0.17 0.18 0.28
C 0.32 0.20 0.17 0.31
T 0.30 0.23 0.19 0.27
G 0.25 0.20 0.17 0.37
39Markov Models (Cont.)
- We can use this for both the binding site model
and the background (random) model. The more
realistic the model, we hope to get more
realistic p values. - We obtain a tradeoff. As we increase m
- Advantages
- More reliable p values ?
- Reduce false positive/negative errors ?
- Drawbacks
- Need more data to represent the model ?
- Computational complexity increases ?
40Other Possible Directions
- Account for multiple occurrences P(H n).
- Account for combinations of motifs. Find pairs
(or larger groups) which are statistically
significant. - Use close genomes (e.g. human and mouse) in order
to reduce false positives rate. - Combine with expression data (how ?)
41The END
Thanks to
- Ido Kanter
- Gaddy Getz
- Eytan Domany