DNA Fingerprinting:

1

• DNA Fingerprinting
• The DNA of every individual is different. Loci
  where the human genome differs from individual to
  individual are called polymorphisms.
• Polymorphisms may be different alleles of a gene
  (different base-pair sequences), such as the ABO
  human blood group multiple alleles.
• Some polymorphisms are genes that exist in
  variable copy number.
• Other polymorphisms are non-coding DNA that
  varies in both base-pair sequence and copy
  number, e.g. tandem repeats.
• Tandem repeats are short DNA sequences that are
  non-coding and repeat at specific loci a variable
  number of times. Both the sequence and the
  copy-number of these repeats vary from individual
  to individual. These are the polymorphisms
  targeted by DNA fingerprinting. E.g. there is a
  region of DNA just beyond the insulin gene on
  chromosome 11, consisting of 7 to 40 repeats,
  depending on the individual. E.g.
  TCATTCATTCATTCATTCAT is a short tandem repeat
  (STR) of 4 base pairs that repeats 5 times at the
  locus shown.
• Ten or more different loci containing similar
  variable number tandem repeats are tested,
  ensuring that the odds of a coincidental match
  are less than one in a billion or even one in a
  trillion. These tandem repeats are used since the
  whole human genome would be too much to analyse!
• Procedure of DNA Fingerprinting in a forensic
  setting
• A DNA sample must be obtained from the crime
  scene, e.g. a sample of spilt blood. If the
  sample is large enough then DNA can be purified
  in sufficient quantities, if the sample is too
  small then PCR must be used to amplify the DNA in
  the sample.
• The purified DNA is cut by restriction
  endonucleases at either side of several loci
  containing variable number tandem repeats
  (VNTRs). If the DNA has been amplified by PCR
  then rather than restrict the DNA, it is possible
  to use primers for DNA either side of these VNTR
  loci to only amplify these portions of DNA.
• Obtain DNA from the victim and from the suspects
  by taking blood samples. Restrict or amplify
  these samples to obtain the same VNTR loci in
  these people.
• Separate the various VNTR DNA sequences obtained
  from each person by gel electrophoresis. Use
  markers DNA fragments of known and decreasing
  length. Also use a control DNA that has been
  fingerprinted before, to make sure that the
  markers are reliable. DNA from the technician may
  also be tested as an internal control in case of
  DNA contamination.
• Compare the DNA fingerprints of each suspect with
  the DNA sample from the crime scene. If DNA from
  one of the suspects exactly matches the sample
  DNA then a match ahs been obtained.

2
DNA Fingerprinting Exercise Blood found at a
murder scene is thought to be that of the
attacker (there was a vicious fight and the
attacker did not got away unscathed!). We have
three suspects. Carry out a DNA fingerprint on
blood samples from each suspect and on blood
found at the scene. We are going to use
restriction endonucleases and for simplicity we
will only test two loci (we arent really
bothered about catching the real murderer, just
so long as we get a conviction!). Solve the
crime! 1. Restrict each DNA sample with the
following restriction endonucleases ECORI
GAATTC and Hind III AAGCTT CTT
AAG TTCGAA And calculate the
fragment sizes in bp. Suspect one has been done
for you already
29 bp fragment
-GGCTACTGGAAGCTTAATGTCGGTCGGTCGGTCGGTCGTTCGAATTGCA
TGGGCG- -CCGATGACCTTCCAATTACAGCCAGCCAGCCAGCCAGCAAG
CTTAACGTACCCGC-
-GGCTATGGAATTCGGGTATAGTATAGTATAGCCAAGCTTGCTATTGCCC
TGAGGCC- -CCGATACCTTAAGC CCATATCATATCATATCGG
TTCGAACGATAACGGGACTCCGG-
26 bp fragment
Suspect 2
-CTGGAAGCTTGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGCCTTC
GAAT- -GACCTTCGAACCGGCCGGCCGGCCGGCCGGCCGGCCGGCCGGC
CGGAAGCTTA-
-TTGAATTCATCGATTAATTAATTACCAAGCTTGCTATTGCCC
TGAGGCCGCTATGCT- -AACTTAAGTAGCTAATTAATTAATGGTTCGAA
CGATAACGGGACTCCGGCGATACGA-
Suspect 3
-ATTGATTGATGGCTACTGGAAGCTTAACTAACTAACTGCTTCGAATTGC
ATCGGCG- -TAACTAACTACCGATGACCTTCGAATTGATTGATTGACGA
AGCTTAACGTAGCCGC-
-TACCTTAAGCATACATACATACATACATACATACATACATACATACATA
CAATTCGAA- -ATGGAATTCGTATGTATGTATGTATGTATGTATGTATG
TATGTATGTATGTTAAGCTT-
3
2. Plot the position the fragments would take on
the following electrophoretic gel. The blood
found at the scene has already been done for you
Base Pairs (markers)
Crime scene
Suspect 1
Suspect 2
Suspect 3
50bp
40bp
30bp
20bp
10bp
3. Which suspect do you think committed the
murder?

• Uses of DNA fingerprinting
• To test whether or not parents carry a
  disease-causing mutation that may be passed on to
  their offspring, e.g. sickle-cell disease, cystic
  fibrosis.
• To determine the real father of a child (paternal
  testing).
• To test crime suspects to see if their DNA
  matches that found at the crime scene.
• Problems with DNA fingerprinting
• False Negatives mistakenly declaring that there
  is no match.
• False Positives mistakenly declaring that there
  is a match. Is this an acceptable error?
• Although the probability of two people
  coincidentally having matching DNA fingerprints
  is extremely small, the process of obtaining a
  DNA fingerprint by gel electrophoresis is prone
  to experimental error. The same DNA sample will
  never give two identical gels!