Global dissection of cis and trans regulatory variations in Arabidopsis thaliana

1
Global dissection of cis and trans regulatory
variations in Arabidopsis thaliana Xu
Zhang Borevitz Lab
2
Col and Van are collected from distinct
geographic locations
3
Expression regulatory variation can act in cis or
in trans
cis polymorphism
trans polymorphism
gene 1 gene 2 gene 3
regulator 1 regulator 2
4
Dissection of cis and trans variation

• eQTL mapping in segregating populations
• CAUSAL cis and trans variation can be mapped
  individually
• Additive effects and non-additive interactions
  among the eQTL can be assessed
• limited detection power due to the sample size
  and extent of recombination of mapping
  population it actually maps LOCAL and DISTANT
  variation

5
Allele specific expression in a heterozygous
system
allele A
allele B
Allele A and B are exposed to the same pool of
trans factors. Thus allelic expression should be
due to cis difference within or nearby the gene
6
Composite trans effects are inferred by
comparison of hybrids and parents
cis effect
expression level
Col Van
hybrids
cis effect
trans effect
expression level
Col Van
hybrids
7
Dissection of cis and trans variation

• Allele specific expression in a heterozygous
  system
• closely locates cis causal variation
• composite effect of trans variation can be
  inferred by testing the deviation of allelic
  expression in heterozygous from the differential
  expression between homozygous parents
• individual causal loci can NOT be mapped, their
  interaction can NOT be assessed

8
Biological samples for microarray hybridization
Col ? x Van ?
Van ? x Van ?
Van ? x Col ?
Col ? x Col ?

• 4 replicates for parental gDNA11 mix
• 4 replicates for parental mRNA11 mix
• 4 replicates for Col (mother) x Van F1s
• 4 replicates for Van (mother) x Col F1s

9
cis and trans

• The measurement allele intensity ratio of the
  transcript Col allele/Van allele
• parental expression difference
• mRNA 11 mix vs gDNA 11 mix
• cis regulatory difference
• F1s vs gDNA 11 mix
• trans regulatory difference
• F1s vs mRNA 11 mix
• imprinting
• F1c vs F1v

10
AtSNPtile A SNP/tiling array

• 1.4M tiling probes at 35bp resolution
• 1M SNP probes for 250K SNPs
• each SNP 2 alleles x 2 strands
• allele A antisense strand GACCAATTTTGACCCTAGATC
  GCCA
• allele A sense strand CTGGTTAAAACTGGGATCT
  AGCGGT
• allele B antisense strand GACCAATTTTGAACCTAGATC
  GCCA
• allele B sense strand CTGGTTAAAACTTGGATCT
  AGCGGT

11
Allele intensity ratio as a measurement of
allelic difference
log (A / B) of probe intensity
log (A / B) of template mixture
target amount in ug
Across strands and SNPs A Col allele B Van
allele
12
The effect of overall target amount is small
Linear regression for each SNP and strand
13
SNPs within transcribed region
14
The model
Contrast mRNA11 mix gDNA11 mix F1c F1v
Model 1 1 (parental difference) 1 -1 0 0
Model 1 2 -1 -1 1 1
Model 1 3 (imprinting effect) 0 0 1 -1
Model 2 1 -1 1/3 1/3 1/3
Model 2 2 (cis variation) 0 -1 1/2 1/2
Model 2 3 0 0 1 -1
Model 3 1 1/3 -1 1/3 1/3
Model 3 2 (trans variation) -1 0 1/2 1/2
Model 3 3 0 0 1 -1
15
cis only
Here cis variation up-regulates Van allele
16
trans only
Here trans variation up-regulates Col allele
17
FLC
reciprocal F1 hybrids
Van
Col
FLC cis and trans cis variation up-regulates
Col allele trans variation up-regulates Van allele
18
FRIGIDA
FRIGIDA No difference
19
Summary for 12,311 analyzed genes
  Parental difference Parental difference Parental difference Parental difference Parental difference cis cis cis cis cis
Delta Sig Sig- Total FALSE FDR Sig Sig- Total FALSE FDR
0.15 8962 1286 10248 4330 42 5098 3196 8294 3577 43
0.25 8066 1004 9070 1394 15 3839 2274 6113 543 8.9
0.35 7046 695 7741 256 3.3 2800 1618 4418 81 1.8
0.45 5799 501 6300 48 0.77 2002 1183 3185 25 0.80
0.55 4644 360 5004 13 0.25 1500 825 2325 11 0.46
0.65 3558 253 3811 4 0.11 1075 590 1665 5 0.30
0.75 2606 200 2806 1 0.048 773 453 1226 3 0.20
0.85 1657 165 1822 1 0.032 558 344 902 1 0.15
0.95 1077 127 1204 0 0.024 408 265 673 1 0.094
  trans trans trans trans trans imprinting imprinting imprinting imprinting imprinting
Delta Sig Sig- Total FALSE FDR Sig Sig- Total FALSE FDR
0.15 45 10018 10063 4627 46 11 0 11 2895 26317
0.25 12 8121 8133 1542 19 4 0 4 295 7379
0.35 6 6326 6332 302 4.8 3 0 3 8 282
0.45 5 4422 4427 47 1.1 3 0 3 1 37
0.55 3 2907 2910 11 0.37 0 0 0 0 NA
0.65 3 1685 1688 2 0.15 0 0 0 0 NA
0.75 3 729 732 1 0.080 0 0 0 0 NA
0.85 3 248 251 0 0.085 0 0 0 0 NA
0.95 2 91 93 0 0.080 0 0 0 0 NA

An over-estimation of cis variation genes
20
The direction of cis and trans effects relative
to that of parental expression difference
21
The size of cis and trans effects relative to
that of parental expression difference
cis vs parental difference trans vs
parental difference trans vs cis
22
Validation for microarray result by single base
extension coupled with Mass-spectrometry
(? 0.74, p lt 1.08E -06, n32)
23
Regional difference in sequence polymorphism
between cis and trans genes
24
Gene regulatory network
Regulatory genes
Structural genes
(Wittkopp 2004)
25
Chromosomal distributions of cis and trans genes
Sliding window of 120 genes
26
Correlation of chromosomal distributions among
cis, trans, sequence polymorphism and gene
distance
model chr1 (df3105) chr1 (df3105) chr2 (df1500) chr2 (df1500) chr3 (df2418) chr3 (df2418) chr4 (df1831) chr4 (df1831) chr5 (df2852) chr5 (df2852) overall (df11714) overall (df11714)
model ? p-value ? p-value ? p-value ? p-value ? p-value ? p-value
cistrans -0.071 8.04E-05 -0.50 2.20E-16 -0.56 2.20E-16 0.22 2.20E-16 -0.40 2.20E-16 -0.28 2.20E-16
cisdistance 0.34 2.20E-16 0.48 2.20E-16 0.52 2.20E-16 0.20 2.20E-16 0.44 2.20E-16 0.39 2.20E-16
transdistance -0.56 2.20E-16 -0.17 7.11E-11 -0.60 2.20E-16 -0.14 2.47E-09 -0.41 2.20E-16 -0.41 2.20E-16
cispolymorphism 0.34 2.20E-16 0.65 2.20E-16 0.62 2.20E-16 0.28 2.20E-16 0.51 2.20E-16 0.48 2.20E-16
transpolymorphism -0.48 2.20E-16 -0.29 2.20E-16 -0.72 2.20E-16 -0.28 2.20E-16 -0.46 2.20E-16 -0.45 2.20E-16
polymorphismdistance 0.58 2.20E-16 0.83 2.20E-16 0.80 2.20E-16 0.62 2.20E-16 0.62 2.20E-16 0.69 2.20E-16
Sliding window of 120 genes
27
CG methylation for cis or trans genes
CG methylation within promoter repression gene
expression CG methylation within gene proper
facilitate gene expression
28
Histone modification for cis and trans genes
H3K27me3 Histone 3 lysine 27 trimethylation H3K9m
e3 Histone 3 lysine 9 trimethylation LND low
nucleosome density regions
29
Gene expression specificity for cis and trans
genes
expression level
expression entropy
gene length
Data from Schmid et al, 2005 63 diverse tissues
on Col wild type background
30
Conclusions

• Large cis effect but more trans effect
• cis genes tend to locate in polymorphic,
  gene-poor chromosomal regions, where repressive
  epigenetic modifications are enriched and gene
  expression is tightly regulated
• trans genes tend to locate in conserved,
  gene-rich chromosomal regions, where activating
  epigenetic modifications are dominant and gene
  expression is more constitutive

31
Allele specific intron expression

• Intron retention is common in plant
• Allele specific intron expression suggests
  differential intron splicing

32
Summary for 6,707 analyzed introns
  Parental difference Parental difference Parental difference Parental difference Parental difference cis cis cis cis cis
Delta Sig Sig- Total FALSE FDR Sig Sig- Total FALSE FDR
0.15 3238 1446 4684 1251 27 2997 1933 4930 1592 32
0.25 2430 1014 3444 150 4.4 2327 1448 3775 192 5.1
0.35 1806 731 2537 21 0.83 1783 1101 2884 42 1.5
0.45 1283 504 1787 5 0.27 1367 777 2144 15 0.69
0.55 803 399 1202 1 0.12 995 589 1584 6 0.39
0.65 502 289 791 1 0.065 675 449 1124 3 0.25
0.75 341 205 546 0 0.039 488 335 823 1 0.16
0.85 212 159 371 0 0.032 335 265 600 1 0.11
0.95 139 118 257 0 0.023 231 211 442 0 0.070
  trans trans trans trans trans imprinting imprinting imprinting imprinting imprinting
Delta Sig Sig- Total FALSE FDR Sig Sig- Total FALSE FDR
0.15 14 690 704 1422 202 20 99 119 1094 919
0.25 4 151 155 59 38 13 3 16 43 267
0.35 1 41 42 7 17 0 0 0 3 NA
0.45 0 7 7 2 27 0 0 0 1 NA
0.55 0 0 0 1 NA 0 0 0 0 NA
0.65 0 0 0 0 NA 0 0 0 0 NA
0.75 0 0 0 0 NA 0 0 0 0 NA
0.85 0 0 0 0 NA 0 0 0 0 NA
0.95 0 0 0 0 NA 0 0 0 0 NA
33
Distribution of sequence polymorphisms along up-
and down-stream exons and the cis intron
intron
upstream exon
downstream exon
34
Conclusions

• extensive intron splicing variation
• largely contribute by cis variation, no trans
  effect detected

35
Acknowledgements
Borevitz Lab Justin Borevitz Yan Li
Christos Noutsos Geoffrey Morris Andrew Cal
Paul Grabowski Traci Viinanen Whitney
Panneton
Greenhouse Judy Coswell Sandra Suwanski
John Zdenek