Objectives

1
Chapter 13 - Molecular Methods

• Objectives
• Be able to describe what a gene probe is and what
  it can be used for.
• Understand the PCR reaction.
• Be able to describe the different types of PCR
  normal, RT-PCR, ICC-PCR, multiplex PCR,
  seminested PCR, PCR fingerprinting, real-time
  PCR, in situ PCR. Be able to give an example of
  the use of each of these types of PCR.
• Understand the different types of PCR
  fingerprinting techniques including AP-PCR,
  REP-PCR, ERIC-PCR. Be able to give an example
  application of a PCR fingerprinting technique.
• Understand RFLP and its application to forensics.
• Be able to define cloning, cloning vector, and
  alpha-complementation.
• Understand the concept of metagenomic analysis
• Understand DGGE and TRFLP analysis and its use in
  community analysis.
• Be able to define what a reporter gene is and
  know the different types of reporter genes. Be
  able to give an example of how each of the
  different types reporter genes is used.
• Be able to define what a microarray is and to
  give an example of how a microarray could be used
  to monitor a microbial community.

2
Molecular techniques are based on the structure
of DNA and RNA
3
(No Transcript)
4
Gene probes A gene probe is a short specific
sequence of DNA that is used to query whether a
sample contains target DNA, or DNA
complementary to the gene probe.
CCTAAAGTGGCATTACCCTTGAGCTA
The target sequence can be a universally
conserved region such as the 16S-rDNA gene or it
can be in a region that is conserved within a
specific genus or species such as the nod genes
for nitrogen fixation by Rhizobium or the rhl
genes for rhamnolipid biosurfactant production by
Pseudomonas aeruginosa.
5
PCR-Polymerase Chain Reaction In many cases
there is not enough DNA in a sample for a gene
probe to detect. Sample DNA can be amplified
using PCR.

• Need
• Target DNA
• Primers 17 to 30bp, GC content gt50
• Primers can be for universal conserved sequences
  (16S rDNA, dehydrogenase genes) or genus-level
  conserved sequences (Nod, Rhl, LamB genes)
• dNTPs
• DNA polymerase (original was taq polymerase from
  Thermus aquaticus. Now there are several other
  DNA polymerases available)

6
PCR Round 1
DNA polymerase always adds nucleotides to the 3
end of the primer
7
PCR Round 2
After the second round of PCR, the number of long
strands increases arithmetically and the number
of short strands increases exponentially (the
number of chromosomal strands is always the same).
denaturation
primer annealing
extension
8
Temperature control in a PCR thermocycler
Temperature 0C
94 0C - denaturation
50 70 0C - primer annealing
72 0C - primer extension
94 0C - denaturation
9
After 25 cycles have 3.4 x 107 times more DNA
DNA
plateau is reached after
25-30 cycles
PCR cycles
10
A PCR product should be confirmed in at least two
ways initially.

• These can include
• Correct product size.
• Sequence the product.
• Use a gene probe to confirm the product.
• Use seminested PCR (see later)

11
RT-PCR The enzyme reverse transcriptase is used
to make a DNA copy (cDNA) of an RNA template from
a virus or from mRNA.
Normal PCR with two primers
12
Multiplex PCR Use of multiple sets of primers to
detect more than one organism or to detect
multiple genes in one organism. Remember, the
PCR reaction is inherently biased depending on
the GC content of the target and primer DNA. So
performing multiplex PCR can be tricky.
13
Seminested PCR Three primers are required, the
normal upstream and downstream primers as well as
a third, internal primer. Two rounds of PCR are
performed, a normal PCR with the upstream and
downstream primer, and then a second round of PCR
with the downstream and internal primer. A
second smaller product is the result of the
second round of PCR.
14
ICC-PCR Integrated cell culture PCR is used for
virus detection. Cell culture takes 10 15 days.
PCR alone detects both infectious and
noninfectious particles. So use a combination of
these techniques grow the sample in cell
culture 2 3 days, release virus from cells and
perform PCR. This results in the detection of
infectious virus in a shorter time with a 50
cost savings. It also allows use of dilute
samples which reduces PCR inhibitory substances.
15
Labelling approaches CYBR green
Real-Time PCR This technique allows
quantitation of DNA and RNA. Reactions are
characterized by the point in time during cycling
when amplification of a PCR product is first
detected rather than the amount of PCR product
accumulated after a fixed number of cycles. The
higher the starting copy number of the nucleic
acid target, the sooner a significant increase in
fluorescence is observed.
TAQ-man probes
FRET probes
16
PCR fingerprinting
AP-PCR (arbitrarily primed PCR), 1 primer
required, 10-20 bp, no sequence information
required REP-PCR (repetitive extragenic
palindromic sequences) 2 primers insert randomly
into the REP sites ERIC-PCR (enterobacterial
repetitive intergenic consensus sequences), 2
primers insert randomly into the ERIC sites, best
for Gram Negative microbes All of these
fingerprinting techniques tell one if two
isolates are the same or different. They do not
provide information about the identity or
relatedness of the organisms
17
RFLP Fingerprinting Analysis
RFLP restriction fragment length
polymorphism RFLP analysis involves cutting DNA
into fragments using one or a set of restriction
enzymes. For chromosomal DNA the RFLP fragments
are separated by gel electrophoresis, transferred
to a membrane, and probed with a gene probe. One
advantage of this fingerprinting technique is
that all bands are bright (from chromosomal DNA)
because they are detected by a gene probe.
AP-PCR, ERIC-PCR, and REP-PCR all have bands of
variable brightness and also can have ghost
bands. For PCR products a simple fragment
pattern can be distinguised immediately on a gel.
This is used to confirm the PCR product or to
distinguish between different isolates based on
restriction cutting of the 16S-rDNA sequence
ribotyping. Also developed into a diversity
measurement technique called TRFLP.
18
Recombinant DNA techniques

• Cloning the process of introducing a foreign
  piece of DNA into a replication vector and
  multiplying the DNA.
• Recombinant DNA - foreign DNA inserted into a
  vector.
• These approaches are used to
• Find new or closely related genes
• Insert genes into an organism, e.g., an
  overproducer
• Produce large amounts of a gene

Cloning
19
Recombinant DNA
20
Selection of recombinants by alpha complementation
21
Metagenomics

• Genetic analysis of an entire microbial
  community.
• Metagenomics involves the cloning of large
  fragments of DNA extracted from the environment,
  allowing analysis of multiple genes encoded on a
  continuous piece of DNA as well as allowing
  screening of large environmental fragments for
  functional activities.
• Two main approaches
• sequence analysis of all DNA present
• advantage allows unparalleled access to
  the genetic information in a sample
• disadvantage difficulty in organization
  and interpretation of the sequenced
• information
  obtained from complex communities
• directed sequencing for identity (16S rRNA gene
  or a functional gene)
• advantage allows rapid access to specific
  identity or functional data from an
• environmental sample
• disadvantage provides more limited
  information about the sample

22
DGGE Analysis
DGGE denaturing gradient gel electrophoresis DG
GE is a way to separate multiple PCR products of
the same size. These products can be generated
by a 16S-rRNA PCR of community DNA. DGGE uses
either a thermal or a chemical denaturing
gradient to separate bands on the basis of their
GC content. Once the bands are separated they
can be sequenced to allow identification. The
banding patterns themselves can be used to
evaluate whether changes in the population are
taking place. Note of caution PCR is
inherently biased, some primers work better with
some target sequences than others and primers
will preferentially amplify targets that are
present in high concentration. So scientists
still dont know how accurately this type of
analysis depicts the population actually present.
23

• TRFLP Analysis
• TRFLP (terminal restriction fragment length
  polymorphism analysis)
• A way to separate multiple PCR products of the
  same size. These products can be generated by a
  16S-rRNA PCR of community DNA
• The PCR is performed as usual with two primers,
  but one is fluorescently labeled
• The PCR products are then cut up using a
  restriction enzyme
• The fluorescently labeled PCR pieces are detected
• TRFLP steps
• 1. Extract community DNA
• 2. Perform 16S rRNA PCR using fluorescently-label
  ed primer
• 3. Choose a restriction enzyme for TRFLP that
  will give the greatest diversity in restriction
  product size

24
Gel electrophoresis analysis
Automated DNA analyzer
25
Some approaches for analysis of the various
bacterial communities present in environmental
samples

• Culture and identify via 16S-rRNA PCR and
  sequencing
• Extract DNA, subject to 16S-rRNA PCR, clone, then
  sequence
• clone libraries
• 3. Extract DNA, subject to metagenomic analysis
• 4. Extract DNA, subject to 16S-rRNA PCR, then
  DGGE analysis
• 5. Extract DNA, subject to 16S-rRNA PCR, then
  TRFLP analysis

Discuss the advantages and disadvantages of each
of these approaches
26
Reporter genes
Reporter genes are genetic markers that are
inserted into the organism of interest to allow
easy detection of the organism or its
activity. Examples of reporter genes
lux genes (luminescence), gfp genes (green
fluorescent protein), beta-galactosidase gene
(produces blue color).
insert
reporter
gene
27
Microarrays Constructed using probes for a known
nucleic acid sequence or for a series of targets,
a nucleic acid sequence whose abundance is being
detected.
GeneChip microarrays consist of small DNA
fragments (referred to also as probes),
chemically synthesized at specific locations on a
coated quartz surface. By extracting, amplifying,
and labeling nucleic acids from experimental
samples, and then hybridizing those prepared
samples to the array, the amount of label can be
monitored at each feature, enabling either the
precise identification of hundreds of thousands
of target sequence (DNA Analysis) or the
simultaneous relative quantitation of the tens
of thousands of different RNA transcripts,
representing gene activity (Expression Analysis).
28
Affymetrix gene arrays for specific
organisms Arabidopsis Genome Arrays B. subtilis
Genome Array (Antisense) Barley Genome Array C.
elegans Genome Array Canine Genome Array
Drosophila Genome Arrays E. coli Genome Arrays
Human Genome Arrays Mouse Genome Arrays P.
aeruginosa Genome Array Plasmodium/Anopheles
Genome Array (malaria) Rat Genome Arrays S.
aureus Genome Array Soybean Genome Array Vitis
vinifera (Grape) Array Xenopus laevis Genome
Array Yeast Genome Arrays Zebrafish Genome Array
29
Microarray technology is developing fast beyond
pure culture In 2005, arrays are containing gt
250,000 probes. In 2006, arrays are containings
gt 500,000 probes. Microarray analysis is
developing the next generation of chips to
examine who is in environmental samples and
what they do Phylochip is a microarray with
DNA signatures for 9000 known species in the
phyla of Bacteria and Archaea to examine who is
there. Geochip is a microarray with DNA
signatures for various functional genes to
examine what functions are present