Title: Why bioinformatics ?
1New Insights in Bioinformatics Metsada
Pasmanik-Chor Bioinformatics Unit, Life Science,
TAU
- Topics
- Why bioinformatics ?
- Classical bioinformatics-
- similarity, conserved
- regions and alignments
- The post-genome era-
- high throughput tools and
- complex system analysis
2From Sequences to Functional Proteins - the
Central Dogma of Molecular Biology
CGCCAGCTGGACGGGCACACCATGAGGCTGCTGACCCTCCTGGGCCTTCT
GTGTGGCTCGGTGGCCACCCCCTTAGGCCCGAAGTGGCCTGAACCTGTGT
TCGGGCGCCTGGCATCCCCCGGCTTTCCAGGGGAGTATGCCAATGACCAG
GAGCGGCGCTGGACCCTGACTGCACCCCCCGGCTACCGCCTGCGCCTCTA
CTTCACCCACTTCGACCTGGAGCTCTCCCACCTCTGCGAGTACGACTTCG
TCAAG
Sequence data Strings of letters
3The Biotechnology Revolution Requires
Bioinformatics Advancement
4The Human Genome Project (HGP)
- Goals
- Sequence the human genome
- Identify all genes
- Predict gene function
- Determine involvement
- in human diseases.
- Note
- Only 1 fully achieved so far
Francis Collins (head of public project, NIH)
I think this is probably the most important
scientific effort that mankind has ever mounted.
That includes splitting the atom and going to the
moon.
5The Human Genome Project ELSI
Address the Ethical, Legal, and Social
Implications (ELSI) that may arise from the HGP.
6DNA Variability SNPs and the HapMap Project
- DNA is identical in all cells of an
- individual, and almost identical among
- different individuals of same species
- (99.9 in humans).
- For a variation to be considered
- SNP, it must occur in at least 1
- of the population.
The HapMap is a catalog of common genetic
variants (haplotypes) in human, and their
associations. Goal Understand polymorphisms
in terms of potential functionality, and
relevance to human health.
http//www.nature.com/nature/journal/v437/n7063/pd
f/4371241a.pdf
7DNA Variability SNPs and the HapMap Project
Example of visualization for a non-synonymous SNP
from alcohol dehydrogenase (PDB code 1htb).
Surface pocket
R mutation47
Nucleic Acids Res. 2004 January 1 32 (Database
issue) D520D522 http//www.pubmedcentral.nih.gov
/articlerender.fcgi?artid308838
8Sequenced Genomes
No. of genes
How Many Sequenced Genomes? Currently (May
20th, 2007) 558 complete genomes
available and more than 2,500 on-going
projects !
Eukarya Bacteria Archea
49 468 41
http//www.genomesonline.org/
9Mouse and Human Not So Far Apart
Approx. 150 cut and paste operations will
transform humans into mice.
http//www.public.iastate.edu/semrich/compgen/cg
-header.gif