Journal Club

1
?14???????? ?? 3?28?
2
Journal Club
Sone H, Tanaka S, Iimuro S, Tanaka S, Oida K,
Yamasaki Y, Oikawa S, Ishibashi S, Katayama S,
Yamashita H, Ito H, Yoshimura Y, Ohashi Y,
Akanuma Y, Yamada N Japan Diabetes Complications
Study Group. Long-term lifestyle intervention
lowers the incidence of stroke in Japanese
patients with type 2 diabetes a nationwide
multicentre randomised controlled trial (the
Japan Diabetes Complications Study). Diabetologia.
2010 Mar53(3)419-28. Petersen KF, Dufour S,
Hariri A, Nelson-Williams C, Foo JN, Zhang XM,
Dziura J, Lifton RP, Shulman GI. Apolipoprotein
C3 gene variants in nonalcoholic fatty liver
disease. N Engl J Med. 2010 Mar 25362(12)1082-9.
2010?4?1? 830-855 8? ??

• ?????? ???????? ????????
• Department of Endocrinology and Diabetes,
• Saitama Medical Center, Saitama Medical
  University
• ?? ??
• Matsuda, Masafumi

3
H. Sone N. Yamada Department of Internal
Medicine, University of Tsukuba Institute of
Clinical Medicine, Ibaraki, Japan S. Tanaka
Laboratory of Biostatistics, Tokyo University of
Science, Tokyo, Japan S. Iimuro Y. Ohashi
Department of Biostatistics, University of Tokyo
School of Medicine, Tokyo, Japan S. Tanaka
Translational Research Center, Kyoto University,
Kyoto, Japan K. Oida Fukui Chuo Clinic, Fukui,
Japan Y. Yamasaki Center for Advanced Science and
Innovation, Osaka University, Osaka, Japan S.
Oikawa Department of Medicine, Nippon Medical
School, Tokyo, Japan S. Ishibashi Department of
Endocrinology and Metabolism, Jichi Medical
College, Tochigi, Japan S. Katayama The Fourth
Department of Medicine, Saitama Medical School,
Saitama, Japan H. Yamashita Department of
Ophthalmology, Yamagata University School of
Medicine, Yamagata, Japan
4
Aim
The aim of the study was to clarify whether a
therapeutic intervention focused on lifestyle
modification affected the incidence of vascular
complications in patients with established
diabetes.
5
Method
A total of 2,033 eligible Japanese men and women
aged 4070 years with type 2 diabetes from 59
institutes were randomised to a conventional
treatment group (CON), which continued to receive
the usual care, and a lifestyle intervention
group (INT), which received education on
lifestyle modification regarding dietary habits,
physical activities and adherence to treatment by
telephone counselling and at each outpatient
clinic visit, in addition to the usual care.
Randomisation and open-label allocation were done
by a central computer system. Primary analysis
regarding measurements of control status and
occurrence of macro- and microvascular
complications was based on 1,304 participants
followed for an 8 year period.
6
previously diagnosed patients with type 2
diabetes aged 4070 years whose HbA1c levels were
6.5.
Patients in the INT group also received 15 min
telephone counselling sessions at least once
every 2 weeks
Initially registered from January 1995 to March
1996.
7
Goals were set for patients in the INT group and
their physicians i.e. HbA1c level lt6.5 BMI lt22
kg/m2 BP lt140/85 mmHg serum cholesterol level
lt5.72 mmol/l (220 mg/dl) serum triacylglycerol
level lt1.65 mmol/l (150 mg/dl) serum
HDLcholesterol gt1.04 mmol/l (40 mg/dl) WHR lt0.9
for men and lt0.8 for women smoking cessation
and abstinence from alcohol. Goals regarding BP
and serum cholesterol levels were updated in
accord with the revision of guidelines made by
the Japan Diabetes Society, which were lt130/80
mmHg and lt5.17 mmol/l (200 mg/dl), respectively.
8
a duration of 10.97.2 years (both mean SD)
Chol 5.2 mmol/L (200 mg/d) TG 1.19 mmol/L (105
mg/dl) 1.09 ?95
9
Retinopathy
Nephropathy
83 (n75) were brain infarction, 9 (n8) were
brain haemorrhage and 8 (n7) were transient
ischaemic attack.
Stroke
CHD
? -40
Fig. 2 KaplanMeier curves for each complication.
a Nephropathy, p1.00. b Retinopathy, p0.43. c
CHD, p0.40. d Stroke, p0.02. p values by
logrank test. Dotted curves, CON solid curves,
INT
10
Table 2 Risk factors for stroke analysed by Cox
univariate and multivariate models
All significant variables selected for the
univariate analysis with the criterion of a plt0.1
were used in the multivariate analysis
11
The mechanism of this apparent contradictory
result is yet to be determined but it should be
interpreted with care, especially since BP, which
is a major risk factor for stroke, did not differ
significantly between groups throughout the study
period. Multifactorial or combined effects of
lifestyle education/behaviours beyond individual
factors 31 might have existed but can only be
speculated upon. At the same time, the slight but
significant differences in HbA1c in the first 3
years, which was reported previously 21, but
that disappeared thereafter, could enhance the
effects since past interventions to lower HbA1c
reportedly have had a very long-term effect (i.e.
metabolic memory or legacy effect) 32, 33.
Other speculations for the apparent contradictory
result include possible improvement in factors
that were not determined in this study, such as
postprandial glycaemia/ lipaemia, BP at home or
psychological factors (stress, motivation or
quality of life) 34, which could be ameliorated
in the INT group rather than in the CON group.
For example, Roumen et al. 35 recently reported
that a lifestyle intervention successfully
improved postprandial glucose levels in IGT
patients. Changes in diet might also be
effective, such as an increase in fruit intake,
which is reportedly associated with reduced CVD
mortality 36. The reasons that only stroke, but
not CHD or other complications, was found to be
responsive to our intervention are speculated to
include the following (1) stroke is more
frequent than CHD in Japan compared with other
parts of the world, and (2) the independent risk
factor for stroke was only systolic BP and
lipoprotein(a), and so there would be room for
other undetermined risk factors to work.
12
Results
Although status of control of most classic
cardiovascular risk factors, including body
weight, glycaemia, serum lipids and BP, did not
differ between groups during the study period,
the incidence of stroke in the INT group
(5.48/1,000 patient-years) was significantly
lower than in the CON group (9.52/1,000
patient-years) by Kaplan Meier analysis (p0.02
by log rank test) and by multivariate Cox
analysis (HR 0.62, 95 CI 0.390.98, p0.04). The
incidence of CHD, retinopathy and nephropathy did
not differ significantly between groups.
Lipoprotein(a) was another significant
independent risk factor for stroke.
13
Conclusion
These findings suggest that lifestyle
modification had limited effects on most typical
control variables, but did have a significant
effect on stroke incidence in patients with
established type 2 diabetes.
14
Limitations
First, our participants were hospital-based
patients with diabetes of a relatively long
duration. Therefore, we cannot make inferences
beyond a similar group. Second, only Asian
diabetic patients were involved and they are
different from other ethnic groups in terms of
degree of obesity. Third, we had a low follow-up
rate, since the study was done mainly in large
hospitals in urban areas where patients move
quite frequently.
15
Message
JDCS??????HbA1C(JDS)?????????,??????? ???3???????
? ????,??????? ?????????????? ????????!?
?,????????? ???????????
16
(No Transcript)
17
From the Departments of Internal Medicine
(K.F.P., A.H., X.-M.Z., J.D., R.P.L., G.I.S.),
Genetics (C.N.-W., J.N.F., R.P.L.), and Cellular
and Molecular Physiology (G.I.S.), and the Howard
Hughes Medical Institute (S.D., R.P.L., G.I.S.),
Yale University School of Medicine, New Haven,
CT.
N Engl J Med 20103621082-9.
18
Background
Asian Indian
Nonalcoholic fatty liver disease is associated
with hepatic insulin resistance and type 2
diabetes mellitus. Whether this association has a
genetic basis is unknown.
19
Method
In 95 healthy Asian Indian men, a group known to
have a high prevalence of nonalcoholic fatty
liver disease, we genotyped two single-nucleotide
polymorphisms (SNPs) in the gene encoding
apolipoprotein C3 (APOC3) that are known to be
associated with hypertriglyceridemia (rs2854116
T-455C and rs2854117 C-482T). Plasma
apolipoprotein C3 concentrations, insulin
sensitivity, and hepatic triglyceride content
were measured. We also measured plasma
triglyceride concentrations and retinyl fatty
acid ester absorption as well as plasma
triglyceride clearance after oral and intravenous
fat-tolerance tests. Liver triglyceride content
and APOC3 genotypes were also assessed in a group
of 163 healthy nonAsian Indian men.
20
VLDL
21
Genotyping
Genomic DNA was extracted from whole blood using
the SDS/Proteinase-K, Phenol-chloroform method.
Genotypes at SNPs flanking the transcription
start site of Apo C3 (position -455, rs2854116,
and position -482, rs2854117) as well as Apo A5
(position -3, rs651821) were determined by
amplifying the region encompassing the
polymorphic sites followed by direct sequencing.
The segment of Apo C3 was amplified by
polymerase chain reaction using the following
primers 5GAAGGTGAACGAGAATCAGTCCTG3 and
5GCCTCGGGCCCATCTCAGCCTTTCACACTG 3). The
segment of Apo A5 was amplified using the
primers 5GACCTTTGCGAAGGGGTTAGAGCACCAC3 and
5CTCGCGAGCCATCTTCTGCTGATGGATC3. Polymorphic
SNPs in the PNPLA3 gene (GCCACTGTAGAAGGGG/CATGAAGC
AGGAACAT), encompassing the I148M variant
(rs738409) were amplified using primer set
PNPLAV1F 5-GAGCCAACAA CCCTTGGTCC TGTCTG- and
PNPLAV1R 5'-GCTGCCCGG GTAGCCTGGA AATAG-3'. PCR
fragments were sequenced with PNPLAV1F to
determine the genotype.
22
Measurement of Hepatic Triglyceride
Content Hepatic triglyceride content was measured
with proton magnetic resonance spectroscopy on a
BioSpec 4T system (Bruker Daltonics). Localized
spectra of the liver were obtained with the use
of a coil assembly composed of twin elliptical
proton radiofrequency coils (13 cm by 9 cm)
arranged in quadrature. Triglyceride content was
measured by proton respiration-gated, stimulated
echo acquisition mode spectroscopy in a voxel (15
mm by 15 mm by 15 mm) placed in three different
locations within the liver to account for the
heterogeneity of hepatic tissue.
23
(No Transcript)
24
(108 of whom were white, 26 Asian, 15 Hispanic,
and 14 black)
25
due to decreased lipoprotein lipase activity
26
Figure 1. Scattergrams of Liver Triglyceride
Content in Asian Indian and NonAsian Indian Men.
Carriers of APOC3 variant alleles (C-482T,
T-455C, or both) were compared with APOC3
wild-type homozygotes (C-482 and T-455) in terms
of liver triglyceride content. Results are shown
for two groups of Asian Indian men (Panel A) and
for two groups of nonAsian Indian men (Panel B).
The boxes delineate subjects who had nonalcoholic
fatty liver disease (hepatic lipid content
gt5.5), all of whom were carriers of the variant
allele.
(insulin-sensitivity index, 2.02.0 lower-third
percentile for insulin sensitivity9, vs.
3.51.6 Plt0.001).
27
A liquid meal containing 20.9 grams of protein,
76.2 grams of fat, 61 grams of carbohydrate and
60,000 IU/ m2 of Vitamin A was administered
Figure 2. Plasma Triglyceride and Retinyl Fatty
Acid Ester Concentrations after an Oral
Fat-Tolerance Test in Asian Indian Men. Panel A
shows the area under the curve (AUC) for plasma
triglyceride concentrations after an oral
fat-tolerance test in 28 carriers of APOC3
variant alleles (C-482T, T-455C, or both) as
compared with 10 APOC3 wild-type homozygotes.
Data are means SE.
28
Retinyl fatty acid ester concentrations were
measured in order to assess chylomicron and post
chylomicron remnant metabolism
Figure 2. Plasma Triglyceride and Retinyl Fatty
Acid Ester Concentrations after an Oral
Fat-Tolerance Test in Asian Indian Men. Panel B
shows the AUC for plasma retinyl ester
concentrations in the two groups. Data are means
SE.
29
A bolus infusion of Liposyn (20, 0.5 ml/kg,
Abbott Laboratories, North Chicago, IL) per kg
body weight was administered over 2 minutes
30
Individual SNPs and their respective effects on
Apo C3 concentrations Variant alleles total
high risk alleles (T482 or C455 alleles) Variant
haplotypes total haplotypes carrying at least
one risk allele (C482-C455 or T482-C455 the
T482-T455 haplotype was not observed in this
cohort) Variant loci sites with the high
risk allele present
31
?
Clinical characteristics of study participants by
genotype classification
32
Effect of Weight Loss on Hepatic Steatosis and
Insulin Resistance Seven of the subjects with
hepatic steatosis and insulin resistance
underwent a hypocaloric dietary intervention.
Over a period of 3 to 6 months, their average
weight decreased from 80.410.7 kg to 74.910.2
kg (P 0.003). This weight loss was accompanied
by a significant reduction in the liver
triglyceride content (from 14.0 to 3.8, P
0.05). After weight loss, there was a marked
improvement in insulin sensitivity on oral
glucose-tolerance testing, with reductions in
plasma glucose and plasma insulin concentrations
and an increase in the insulin-sensitivity index
(from 1.80.8 to 3.71.4, Plt0.01).
33
DISCUSSION
The APOC3 variants C-482T and T-455C lead to
in-creased plasma concentrations of
apolipoprotein C3, which in turn inhibit
lipoprotein lipase and triglyceride clearance,
thus conferring a predisposition to both fasting?
and postprandial hypertriglyceridemia due to an
increase in chylomicronremnant particles.
Increased concentrations of circulating
chylomicron-remnant particles are then
preferentially taken up by the liver by means of
a receptor-mediated process, resulting in
nonalcoholic fatty liver disease and hepatic
insulin resistance.
34
Results
Carriers of the APOC3 variant alleles (C-482T,
T-455C, or both) had a 30 increase in the
fasting plasma apolipoprotein C3 concentration,
as compared with the wild type homozygotes. They
also had a 60 increase in the fasting plasma
triglyceride concentration, an increase by a
factor of approximately two in the plasma
triglyceride and retinyl fatty acid ester
concentrations after an oral fat-tolerance test,
and a 46 reduction in plasma triglyceride
clearance. The prevalence of nonalcoholic fatty
liver disease was 38 among variant-allele
carriers and 0 among wild-type homozygotes
(Plt0.001). The subjects with nonalcoholic fatty
liver disease had marked insulin resistance. A
validation study involving nonAsian Indian men
confirmed the association between APOC3 variant
alleles and nonalcoholic fatty liver disease.
35
Conclusion
The polymorphisms C-482T and T-455C in APOC3 are
associated with nonalcoholic fatty liver disease
and insulin resistance.
36
Message
??????????????????????????????(????? ApoC3
????????????????????????????????) ????5kg???????
??TG???14??3.8???????! ????????(Matsuda
Index)?1.8??3.7???????