Genetics: The source of variability for evolution

1
Genetics The source of variability for evolution

• How population survival strategies determine
  human biology and provides the basic background
  for human variation

2
(No Transcript)
3
What does the genetic material do, anyway?

• 1. Transmits genetic information from one
  generation to the next (for example, in spite of
  the fact that all living things have the same
  genetic materials that govern their development,
  humans always produce human infants and not baby
  rats or elephants).
• 2. Since every cell in the body (with several
  exceptions) has more or less the same genetic
  material as the original cell (the fertilized
  egg), the genetic material must be able to
  reproduce itself when new cells are produced
  during growth and development as well as normal
  body maintenance.
• 3. The genetic materials are organized around
  a sequence of chemical bases that encode for
  the synthesis of proteins, a huge class of
  chemicals that perform a wide range of functions
  in the body.

4
A major function of the DNA coding for the
synthesis of proteins

• While the functions of the genetic material
  located on the chromosomes are numerous and
  complicated, for our purposes, we can examine the
  major function that of the synthesis of
  proteins.
• Proteins are a very large class of molecules
  which perform a huge array of functions in living
  things. It has been estimated that there are
  over 60,000 different proteins in the human body,
  only about 1500 of which have been identified.
• Proteins differ from one another, and thus
  perform differently, based on their organization
  and makeup.

5
Proteins what distinguishes one from another?

• 1. Proteins are composed of chains of amino acids
  (Polypeptide chains).
• 2. Polypeptide chains have variable lengths.
• 3. The sequence of amino acids along the chains
  vary.
• 4. Proteins can be made up of one or, more
  usually, two or more chains of amino acids.
• 5. Proteins have a folded three dimensional
  structure

6
Amino Acids What are they and where do they come
from?

• Chemical group based on their composition an
  amine and an acid
• Of the 20 common amino acids
• 12 the body can make
• 8 (or 9) must be obtained from foods (these are
  the essential amino acids)

• Glycine (gly) Glutamic acid (glu)
• Alanine (ala) Aspartic acid (asp)
• Valine (val) Isoleucine (Ile)
• Leucine (leu) Serine (ser)
• Threonine (thr) Proline (pro)
• Lysine (lys) Arginine (arg)
• Glutamine (gln) Aspargine (asn)
• Methionine (met) Cysteine (cys)
• Tryptophan(trp) Tyrosine (tyr)
• Histidine (his) Phenylalanine (phe)

7
What is a gene?

• A recipe for a protein, or more accurately, for
  a single polypeptide chain.
• Located at a specific region (locus) on a
  specific chromosome
• Implications
• different chromosomes carry different information
• Obvious Question
• do homologous chromosomes carry the same
  information?

8
(No Transcript)
9
(No Transcript)
10
DNA

• Double helix structure
• Biochemically
• Deoxyribose sugar
• Nucleic Acids
• purines adenine, guanine
• pyrimidines thymine, cytosine
• Base pair rules
• c g
• a t

11
Genes and their protein productsHow does a
gene code for a protein?What is the process
by which the structure of DNA determines the
structure of a protein?

• For example, how is a segment of coding DNA
  translated?
• DNA bases
• CCTGAGGAG
• GGACTCCTC

12
The genetic code

• 1. Only one strand of DNA is the recipe, or
  code
• The genetic code
• three sequential nucleic acids (a codon)
• specify for a specific an amino acid
• DNA CAAGTAGAATGCGGACTTCTT
• AA val his leu thr pro glu glu

13
Code to Protein Shuttle system

• Because the synthesis of an amino acid
  polypeptide chain takes place in the cell proper
  and not in the cell nucleus, the code must be
  copied and transported to this site.
• A messenger transmits DNA sequence to protein
  assembly site
• messenger RNA (Ribose Nucleic Acid)
• distinct from DNA single strand C G A (Uracil,
  U, substitutes for T)
• self-assembles as it reads the DNA by base-pair
  rules
• goes to ribosome, site of protein assembly

14
(No Transcript)
15
(No Transcript)
16
(No Transcript)
17
Case Study Genetics in action at the level of
the population

• Sickle cell anemia
• Background
• 1912 James Herrick
• Case Report
• Blood smear analysis
• 1940s family studies
• Mendelian genetics
• Geographic distribution

18
Red Blood Cells What do they do?

• Origin in bone marrow
• 120 day life cycle
• Oxygen-carriers
• Pick up oxygen in lungs
• Deliver oxygen to body tissues
• By what mechanism?

Rbcsinblood on top half alvertonoutpouch on bottom
19
The Protein Hemoglobin

• A protein in red blood cells (RBCs).
• Helmoglobin functions in the transport of oxygen
  from the lungs to body cells.
• Like almost all proteins, its structure is part
  of the code carried by the chromosomes in the
  nucleus.
• How does hemoglobin carry Oxygen?

20
The function depends on structure How
hemoglobin works

• Three dimensional
• Four components
• Two alpha chains
• chromosome 16
• Two beta chains
• chromosome 11
• Red marks the spot!
• Where oxygen binds
• Iron ion critical here

• Hemoglobin Structure

21
Sickle Cell Anemia

• Sickle Cell
• red blood cell shape
• Anemia
• poor oxygen delivery
• Cause
• abnormal hemoglobin based on an amino acid
  substitution on the Beta chain.
• It is thus a genetic disease.
• There are many other anemias which have other
  bases, including iron deficiency and protein
  deficiency anemias, both of which have mainly
  environmental causes.

22
(No Transcript)
23
Hemoglobin S vs Hemoglobin A(Sickle S vs
Normal A)

• First 6 amino acids

• Beta globin gene
• 146 amino acids
• Hbs beta globin chain
• one different amino acid
• valine replaces glutamic acid at position 6

Valine
Valine
Histidine
Histidine
Leucine
Leucine
Threonine
Threonine
Proline
Proline
Glutamic acid
Valine
A
S
24
What causes the sickling?

• Under certain kinds of stress (high altitude, for
  example), The hemoglobin molecule changes shape
• This results in distortion of RBC
• This produces major functional effects in the
  ability of the RBC to carry oxygen as well as to
  effectively move through the smallest vessels of
  the arterial system, the capillaries.?

25
Why does the hemoglobin do this?

• WHEN Abnormal hemoglobin molecule unstable under
  conditions of low oxygen, high acidity

• HOW Crystalline
• structure results
• WHY? Structural instability

26
Why is the frequency of HbS high in some
populations?
27
Population Frequency of HbS

Heterozygote vs Homozygote?

• In Africa
• In a broad swath across central Africa, 1 in 5
  people are carriers.
• They have the HbS/HbA genotype they are
  heterozygous (heterodifferent)
• The expression of Beta hemoglobin is a
  co-dominant trait
• both proteins are expressed

Dominant vs recessive?
28
HbS and adaptation

• In a population of 100 individuals, calculate the
  number of HbS and HbA alleles if 20 of the
  people are heterozygotic and the rest are
  homozygotic normal.
• What is the percentage of HbS and HbA genes in
  the population?
• Why do you think there are no HbS/HbS
  individuals?

29
Genes vs genotype

• In 100 individuals
• genotype genes
• 20 are HbS/HbA 20 HbS 20 HbA
• 80 are HbA/HbA 160 HbA
• 20 HbS 180
  HbA
• 20/200 10 HbS and 180/20090 HbA
• Thus, the gene frequency of HbS is .1 (10)
• And the gene frequency of HbA is .9 (90)
• Given that HbS/HbS is usually lethal, it would be
  expected that the frequency of HbS would decrease
  over time, but in fact, these frequencies
  remained stable generation after generation.

30
An Environmental factor Malaria

• Disease is
• Mosquito-borne
• A parasite is introduced into the host when blood
  is taken. One of the most deadly of many forms
  of malaria is
• Plasmodium
• falciparum

• Illness is often fatal, with symptoms like
• High fever
• rigor
• sweats
• High mortality
• very high in infants and children
• (It has been estimated for example that each year
  around the world more than 20 million children
  die of malaria).

31
Malaria in Africa

• Symptoms
• fever, rigor, sweats
• Disease organism
• Parasite Plasmodium falciparum
• gambia
• vivax
• malariae
• Vector Mosquito
• Anopheles gambiae vs
• Anopheles funestus

32
Malarial Illness and Parasite

• Illness intensity related to parasite density
• Fewer parasites, less ill

• Mechanisms to decrease parasites
• kill mosquitoes (DDT)
• interrupt parasite lifecycle (anti-malarial
  drugs)
• change the micro-environment of the parasite in
  the body
• parasite needs oxygen

33
How to make the body inhospitable for the
parasite and increase the likelihood of
individual humans survival

• Decrease available oxygen to parasite
• Within limits set by the survivability of the
  host
• Red blood cell biochemistry

34
Natural Selection and the introduction of a new
agricultural technique

• About 2000 years ago, several new domestic plants
  (banana, taro, yams and coconuts) were introduced
  into Central Africa from Malaysia.
• This area, because of its poor soils, was not
  cultivated prior to this time and the local
  populations were gatherer/hunters.
• In this environment, only slash and burn
  agricultural methods would work. This resulted
  in the forest clearing and a markedly more open
  environment.

35
New Environment New Mosquitoes

• Prior to the changes brought about by slash and
  burn agricultural methods, the local mosquito was
  Anopheles funestus, which breeds in shade and
  uses bovids (antelopes) as its main host.
• After the changes from slash and burn, there was
  much more open land and standing water, leading
  to the spread of a new mosquito, Anopheles
  gambiae, from West Africa. This animal breeds in
  sun and uses humans as its primary host.
• As a result, more people contracted malaria, and
  high mortality followed.
• Thus, a mutation that introduced HbS would be
  selected for as a means of conferring some
  resistance against this deadly disease.

36
A New Mutation HbS

• Mutations are random and occur in all
  populations. In the case, individuals with traits
  that are adaptive in the face of parasites have a
  better chance to reach adulthood.
• In central Africa, HbS/HbA individuals
• Parasites use host oxygen, causing conditions
  resulting in sickling of red blood cells
• Anemia is detrimental to parasite survival
• Parasite numbers decrease, individual improves

37
An example of natural selection
38
Many solutions to the malaria problem

• In Southeast Asia, the disease thalassemia
  represents a similar outcome of selection for
  hemoglobin variants
• In the Mediterranean, other red blood cell enzyme
  errors
• The heterozygote has the advantage

39
How are new genes introduced into populations?

• By random mutations that occur in all populations
  at all times. Mutations DO NOT happen because
  the new variation is needed to better adapt a
  population to its environment. Most mutations
  are deleterious and do not survive in a
  population
• New genes are also introduced by people.
• Migration into and out of populations people
  take their genes with them, an example of gene
  flow
• For example, the relative frequency of HbS in the
  populations of African descent in the United
  States has decreased in the past two centuries as
  a result of intermixture with other populations,
  as well as selection against the allele in a
  non-malarial environment.

40
Review 1 Sickle cell anemia

• Random mutation (beta hemoglobin
• gene chromosome 11, at position
• six), producing the sickling allele.
• This modification results in a RBC which
• changes shape when it deoxygenates in
• the terminal capillaries.
• The sickled RBCs limit smooth blood flow,
  preventing tissues from being properly oxygenated.

41
Review 2 Sickle cell anemia

• Those who are homozygous for the
• sickling allele (Hb S / Hb S) usually die
• from the effects of sickle cell disease prior
• to reaching adulthood. This is known as
• sickle cell anemia.
• Those who are heterozygous for the
• allele suffer periodic bouts but can live a
• relatively normal adult existence. This
• form is known as sickle cell trait,

42
Review 3 Sickle cell anemia

• In an environment without any selection
• favoring the sickle cell allele, it would be
• maintained at a very low frequency via
• mutations and, potentially, gene flow.
• This is the situation in many human
• populations in non-malarial environments.

43
Review 4 Sickle cell anemia

• In Central Africa, 2000 years ago, new
• domesticated plants (banana, coconut,
• yams and taro) were introduced into the
• area inhabited by gatherer/hunters.
• Slash and burn agriculture was neces-
• sary in the poor soils, which, over time,
• dramatically changed the environment,
• and bringing about a replacement of the
• Anopheles funestus mosquito by the
• West African A. gambiae.

44
Review 5 Sickle cell anemia

• The introduction of this new mosquito,
• which overwhelmingly uses humans as
• hosts, brought about the spread of a
• deadly form of malaria, Plasmodium
• falciparum.
• Heterozygous individuals, by lowering
• the Oxygen content of their blood, are
• able to limit the reproductive capacity of
• the malarial parasite.

45
Review 6 Sickle cell anemia

• As a result of selection favoring the
• heterozygote, a balanced polymorphism
• evolved in this part of Africa with the
• allele frequency of Hb s reaching 10.
• When the environment changed (spray-
• ing with DDT, for example) or when
• Africans left this area, the frequency of
• the allele decreased, but never to zero.
• An example of human micro-evolution.

46
Concepts you should know and understand after our
discussions I. Basic Genetics

• The differences between chromosomes, gene, allele
• How cell division occurs
• Meiosis
• DNA, RNA and the process of protein synthesis
• How mutations, recombination, translocation
  effect this
• Codon
• The relationship between nucleic acid, amino
  acid, protein
• The human karyotype autosomes, sex chromosomes

47
Concepts you should know and understand after our
discussions II. How genetics works in populations

• The specific case of sickle cell anemia
• An example of a mutation that became advantageous
  to a population
• The specifics of the mutation, the structure and
  function of hemoglobin, how it affects the red
  blood cell, and the effects for the individual
• The selective pressure of malaria
• The nature of the disease, the organism that
  causes it, how it is contracted by people how
  they survive it.
• Why did malaria and sickle cell anemia evolve
  together in a human population?
• An example of balanced selection
• How genetic mutation, natural selection, genetic
  drift and gene flow effect a populations gene
  pool

48
DNA Replication Mitosis

• One crucial function of the DNA is to more or
  less accurately replicate itself during ordinary
  cell division, so that each of the two resulting
  daughter cells receive the same complete set of
  23 pairs of chromosomes as the original parental
  cell.
• This is accomplished by the opening of the DNA
  helix and each single strand reproducing its
  complement to form two sets of the complete
  double helix.

49
(No Transcript)
50
DNA self-replication