Chapter 13: DNA Technology

1
Chapter 13 DNA Technology
2
With all our knowledge of DNA and genes, is there
any way to manipulate DNA?

• Genetic Engineering
• form of applied genetics in which
  genes/DNA are manipulated
• Ex. Genetic engineers believe they can improve
  the foods we eat. Tomatoes are sensitive to
  frost. This shortens their growing season. Fish,
  on the other hand, survive in very cold water.
  Scientists identified a particular gene which
  enables a flounder to resist cold and used the
  technology of genetic engineering to insert this
  'anti-freeze' gene into a tomato.

3
DNA Technology

• Science involved in the ability to manipulate
  genes/DNA
• Purpose
• Treat diseases (Cystic fibrosis)
• Treat genetic disorders (hemophilia, diabetes)
• Improve food crops (better tasting veggies,
  longer shelf life, fungus resistance)
• Improve human life in general (vaccines)

4
How is it all done?

• Recombinant DNA Technology
• Steps in the process                     -I.
  Isolation of DNA extraction
• - II. Copying DNA with
  PCR                    -III. Cutting DNA with
  restriction enzymes                   
  -IV. Comparing DNA with gel eletrophoreisis
• OR V. use as
  vectors in recombinant DNA

5
I. Isolate DNA.

• Remove tissue from organism
• (You will do this in your DNA extraction lab)
• Store at 4C

6
PCR Polymerase Chain Reaction A genetic copy
machine

• The polymerase chain reaction (PCR) is a rapid
  way of amplifying (duplicating) specific DNA
  sequences from a small sample of DNA.

7
II. Copy DNA - PCR

• Polymerase Chain Reaction
• Uses DNA sample, DNA polymerase from T. aquaticus
  (hot springs)
• Think of this process as a molecular
• copying machine

8
III. Cutting DNA - Restriction enzymes
Enzymes that can cut at particular locations in
the DNA - DNA engineering today is totally
dependent on restriction enzymes -Restriction
enzymes are endonucleases - Think of them as
molecular scissors
9
What are restriction enzymes?

• Bacterial enzymes used to cut DNA Different
  bacterial strains express different restriction
  enzymes
• The names of restriction enzymes are derived from
  the name of the bacterial strain they are
  isolated from
• Cut (hydrolyze) DNA into defined and REPRODUCIBLE
  fragments
• Basic tools of gene cloning

10
Names of restriction endonucleases

• Titles of restriction enzymes are derived from
  the first letter of the genus the first two
  letters of the species of organism from which
  they were isolated.
• EcoRI -  from Escherichia coli
• BamHI - from Bacillus amyloliquefaciens
• HindIII - from Haemophilus influenzae
• PstI -  from Providencia stuartii
• Sau3AI - from Staphylococcus aureus
• AvaI -  from Anabaena variabilis

11
Source microorganism Enzyme Recognition Site Ends produced
Arthrobacter luteus Alu I AG?CT Blunt
Bacillus amyloiquefaciens H Bam HI G?GATCC Sticky
Escherichia coli Eco RI G?AATTC Sticky
Haemophilus gallinarum Hga I GACGC(N)5? Sticky
Haemophilus infulenzae Hind III A?AGCTT Sticky
Providencia stuartii 164 Pst I CTGCA?G Sticky
Nocardia otitiscaviaruns Not I GC?GGCCGC Sticky
Staphylococcus aureus 3A Sau 3A ?GATC Sticky
Serratia marcesans Sma I CCC?GGG Blunt
Thermus aquaticus Taq I T?CGA Sticky
12
Restriction enzymes recognize a specific short
nucleotide sequence

• For example, EcoRI recognizes the sequence
  
• 5- G/ A A T T C -3'
• 3'- C T T A A /G -5'

13
Examples of restriction enzymes and the sequences
they cleave

• Palindromes same base pairing forward and
  backwards

14
Lets try some cutting

• Using this piece of DNA, cut it with Eco RI
• G/AATTC
• GACCGAATTCAGTTAATTCGAATTC
• CTGGCTTAAGTCAATTAAGCTTAAG
• GACCG/AATTCAGTTAATTCG/AATTC
• CTGGCTTAA/GTCAATTAAGCTTAA/G

15
What results is

• GACCG AATTCAGTTAATTCG AATTC
• CTGGCTTAA GTCAATTAAGCTTAA G

Sticky end - tails of DNA easily bind to other
DNA strands
Sticky end
16
Blunt Sticky ends

• Sticky ends Creates an overhang. BamH1
• Blunts- Enzymes that cut at precisely opposite
  sites without overhangs. SmaI is an example of an
  enzyme that generates blunt ends

17
IV. Gel Electrophoreisis

• V. Analysis of DNA
• DNA fingerprinting
• Banding pattern of the fragments of cut DNA on a
  special gel medium (agarose)

18
Purpose for DNA fingerprinting

• Comparing banding patterns to determine
  hereditary relationships between people
• Comparing banding patterns of 2 different species
  to determine evolutionary relationship
• Compare samples of blood or tissue for forensic
  purposes (who done it?)

19

• Very accurate method of accessing DNA 99.99
• Odds 1 in 1,000,000,000
• Does not work with identical twins
• Use strands of DNA that have a lot of VNTRs

20
How is it done?

• VNTR analysis variable number tandem repeats -
  we each have non-coding segments on our DNA.
  Fragment lengths varies with each person
• Extract DNA sample from blood or tissues
• Cut DNA using restriction enzymes. Separate
  fragments by gel electrophoresis separates DNA
  fragments by the of base pairs (length of the
  fragment) and charge
• Place DNA sample into wells in the agarose gel
  molecular sieve
• Run a current through the gel. The DNA
  (negatively charged) will migrate from (-) to
  ()5.The larger fragments will not migrate that
  far. The small fragments will go the furthest
• 5. Stain gel and bands in a dye or use a
  radioactive probe to analyze the banding

21
(No Transcript)
22
Now that you have the desired gene or piece of
DNA, what do you do with it?

• V. Recombinant DNA
• Transfer of isolated gene to another organism
  with the purpose of having the organism transfer
  the gene to another.
• Use bacterial plasmids

23

1. The same restriction enzyme used to cut the
   desired gene, is used to splice the plasmid
2. Donor gene (desired gene) is then spliced or
   annealed into the plasmid
3. Plasmid is then returned to bacterium and
   reproduces with donor gene in it.
4. Bacterium with donor gene can transfer donor
   genes to organisms it infects.

24
(No Transcript)
25
How this works to help humans

• Looking at the gene that produces insulin for the
  treatment of diabetes
• Isolate insulin gene from a healthy human
• Using a restriction enzyme, cut out insulin
  producing gene
• Cut bacterial plasmids with same restriction
  enzyme
• Introduce human insulin producing gene to
  bacterial plasmid
• Bacterial plasmid takes up gene - recombinant DNA
• Bacterial plasmid reproduces and starts
  expressing insulin produce gene
• Insulin is produced and harvested from bacteria.

26

• What has been produced is Recombinant DNA - DNA
  with genes from other organisms
• Transgenic organisms have introduced DNA from
  another species in them

27
Practical Use of DNA technology

• Pharmaceutical products insulin, HBCF (human
  blood clotting factor)
• Genetically engineered vaccines to combat viral
  infections (pathogenic disease causing) your
  body recognizes foreign proteins, produces
  antibodies. Introduced viral proteins will
  trigger an immune response and the production of
  antibodies
• Altering viral genomes makes them no longer
  pathogenic now a vaccine

28

• Increasing agricultural yields
• New strains of plants GMO Genetically
  Modified organism. Try this one!!
• Insect resistant plants Insert gene that
  digests larvae when larvae try to eat the plant
  Not always specific to harmful species!!
  Monarch problem
• Disease resistance Fungal resistance in
  tomatoes, corn, soybean
• Herbicide resistance - Round Up wont harm the
  good plants, only the bad plants (weeds)
  cheaper and less labor extensive than weeding
• Getting genes from Nitrogen fixing bacteria
  inserted into plants fix their own nitrogen (a
  must for plants) in N poor soils
• Salt tolerant plants can grow plants where high
  concentrations of salt in the air or soil

29

• Improve quality of produce
• - Slow down the ripening process ship when
  unripened, to market when ripe
• - Enhance color of produce
• - Reduce hairs or fuzz on produce
• - Increase flavor

30
Why GM Foods?
31
(No Transcript)
32
(No Transcript)
33
Safety and Environmental Issues

• All food products are regulated by the
• Food and Drug Administration FDA
• Natl Institutes of Health Recombinant DNA
  Advisory Committee and the Department of
  Agriculture (USDA)
• Environmental Protection Agency (EPA)
• All set standards for safety procedures and
  require permits and labeling (not in US though).
  Look for a 8 before the product code. 84011 GMO
  banana
• Problem with transgenic foods is that an
  introduced gene may produce a protein that
  someone may be sensitive to. FDA does not require
  that on a label

34
Gene Therapy

• Treatment of a genetic disorder (like cystic
  fibrous) by correcting a defective gene that
  causes a deficiency of an enzyme.
• Nasal spray that carries normal enzyme gene. Body
  makes enzyme and patient breathes normally.
  Regular treatments necessary
• Has not been proven to be successful in the long
  term

35
Hello Dolly!
CLONING