Matthew 13:17

1

• Matthew 1317
• 17 For verily I say unto you, That many prophets
  and righteous men have desired to see those
  things which ye see, and have not seen them and
  to hear those things which ye hear, and have not
  heard them.

2
DNA Sequencing

• Timothy G. Standish, Ph. D.

3
Sequenced Genomes

• Over the past three years large scale sequencing
  of eukaryotic genomes has become a reality
• Currently the sequencing of at least 5
  multi-celled eukaryotic genomes has been
  completed
• 1998 Caenorhabditis elegans - 8 x 107 bp - A
  nematode worm
• 2000 Homo sapiens - 3 x 109 bp - Humans
• 2000 Arabidopsis thaliana - 1.15 x 108 - A plant
  related to mustard
• 2000 Drosophila melanogaster - 1.65 x 108 bp -
  Fruit flies
• 2002 Anopheles gambiae 2.78 x 108 bp mosquito
  vector of malaria

4
New Technology

• Rapid sequencing of large complex genomes has
  been made possible by
• Foundational work done over many years and
• Dramatic improvement in DNA sequencing technology
  over the past few years
• In this presentation we will look at both the
  basic principles of DNA sequencing and how
  techniques have been refined to yield the
  dramatic results we now see

5
A Sequencing Timeline
1977 Sanger and Maxam-Gilbert sequencing
techniques developed 1980 M13 vector developed
for cloning, many refinements and application of
computer technology 1990 Improved sequencing
enzymes, fluorescent dyes developed, robotics
used for high throughput 1997 Sacromycetes
Cerevisiae genome sequenced 1999 Caenorhabdits
elegans Human chromosome 22 and about 20
bacterial genomes 2000 Drosophila melanogaster,
Homo sapiens, Arabidopsis thaliana
6
Basic Principles

• All current practical DNA sequencing techniques
  can be divided into four major steps
• Labeling of DNA so that small quantities can be
  easily detected, traditionally done by labeling
  with either P32 or S35
• Generation of fragments for which the specific
  bases at the 3 end are known
• Separation of fragments using gel electrophoresis
  sensitive ennough to resolve differenced in size
  of one nucleotide
• Fragment detection

7
Outline

• In this presentation we will look at
• The Maxam-Gilbert and Sanger methods of DNA
  fragment generation
• Then methods for separation of fragments
• And finally examine how these techniques have
  been refined and automated to allow for rapid
  cheap sequencing of large quantities of DNA

8
The Maxam-GilbertChemical Method

• Three major steps
• DNA to be sequenced is typically labeled at the
  5 end using P32
• Fragments are generated using chemicals that
  break DNA at specific bases
• These fragments are then separated and detected
  using autoradiography
• Polyacylamide Gel Electrophoresis is typically
  used to separate fragments on the basis of single
  nucleotide differences

9
2 Fragment Generation

• A number of chemicals will specifically modify
  the bases in DNA
• Modified bases can then be removed from the
  deoxyribose sugar to which they are attached on
  the sugar-phosphate DNA backbone
• Piperidine, a volatile secondary amine, is used
  to cleave the sugar-phosphate back bone of DNA at
  sites where bases were modified

10
Cleavage at Specific Bases

• Typically 5 reactions are run
• Dimethylsulfate at pH 8.0 results in modification
  of guanine (G)
• Piperidine formate at pH 2.0 breaks glycosidic
  bonds between deoxyribose and both purines,
  guanine (G) and adenine (A), by protination of
  nitrogen atoms
• Hydrazine (rocket fuel!) opens pyrimidine rings
  on both pyrimidines, cytosine (C) and thymine (T)
• Hydrazine in the presence of 1.5 M NaCl only
  reacts with C
• 1.2 N NaOH at 90 oC strongly cleaves at A and may
  also weakly cleave at C

11
Cleavage at Specific Bases

• The trick in chemical sequencing is to not allow
  the reactions to go to completion
• Partial reactions run using the following
  conditions will result in a series of labeled DNA
  fragments whose final base is known
• Dimethylsulfate at pH 8.0 -----------gt G
• Piperidine formate at pH 2.0 -------gt G and A
• Hydrazine ------------------------------gt C and T
• Hydrazine in 1.5 M NaCl -----------gt C
• 1.2 N NaOH at 90 oC -----------------gt A and some
  C

12
Partial ReactionsDimethylsulphate pH 8.0
5NNGACGTACTTA3
13
Partial ReactionsDimethylsulphate pH 8.0
5NNGACGTACTTA3
14
Partial ReactionsDimethylsulphate pH 8.0
Following breaking of the DNA strand at positions
where G was chemically modified, two sets of
fragments result 1) A labeled set all ending
where a G once was and 2) An unlabeled set which
cannot be detected using autoradiography
15
Partial ReactionsHydrazine
5NNGACGTACTTA3
Some, but not all, C and T bases are modified as
the reaction is not allowed to go to completion
16
Partial ReactionsHydrazine
Following breaking of the DNA strand at positions
where C or T was chemically modified, two sets of
fragments result 1) A labeled set all ending
where a C or T once was and 2) An unlabeled set
which cannot be detected using autoradiography
17
Disadvantages

• Toxic chemicals
• Large amounts of radioactivity
• Sometimes ambiguous and frequently ugly
  sequencing gels
• Tricky to read autorads
• Lack of automated methods

18
Sanger Sequencing

• The Sanger sequencing method takes advantage of
  the way that normal DNA replication occurs
• For DNA to be extended using normal DNA
  polymerases, a hydroxyl group must be present at
  the 3 carbon on deoxyribose
• Fragments are generated by spiking reactions with
  small quantities 2 3 dideoxy nucleotides which
  terminate polymerization whenever they are
  incorporated into DNA
• Polymerases used must lack 3 to 5 exonuclease
  proof reading activity for this method to work

19
Dideoxynucleotides

• DNA Sequencing using the Sanger method involves
  the use of 23-dideoxynucleotide triphosphates
  in addition to regular 2-deoxynucleotide
  triphosphates
• Because 23-dideoxynucleotide triphosphates lack
  a 3 hydroxyl group, and DNA polymerization
  occurs only in the 3 direction, once
  23-dideoxynucleotide triphosphates are
  incorporated, primer extension stops

2-dideoxynucleotide monophosphate
20
23dideoxy-nucleotidesTerminateDNAReplicaton
21
Making DNA Fragments

• In Sanger DNA sequencing reactions all the basic
  components needed to replicate DNA are used
• 4 reactions are set up, each containing
• DNA Polymerase
• Primer
• Template to be sequenced
• dNTPs
• A small amount of one ddNTP
• ddATP, ddCTP, ddGTP, ddTTP
• As incorporation of ddNTPs terminates DNA
  replication, a series of fragments is produced
  all terminating with the ddNTP that was added to
  each reaction

22
DNA Sequencing
Plasmid (or phage) with cloned DNA fragment
23
The ddATP Reaction
3AATAGCATGGTACTGATCTTACGCTAT5
5TTATCG
5TTATCGTA
5TTATCGTACCATGA
5TTATCGTACCATGACTAGA
5TTATCGTACCATGACTAGATGCGATA
24
Separation of DNA Fragments

• All current practical sequencing methods rely on
  separation of DNA fragments in such a way that
  differences in length of a single base can be
  resolved
• This is typically done using polyacrylamide gel
  electrophoresis

25
Polyacrylamide Gels

• Polyacrilamide is a polymer made of acrylamide
  (C3H5NO) and bis-acrilamide (N,N-methylene-bis-ac
  rylamide C7H10N2O2)

26
Polyacrylamide Gels

• Acrylamide polymerizes in the presence of free
  radicals typically supplied by ammonium persulfate

27
Polyacrylamide Gels

• Acrylamide polymerizes in the presence of free
  radicals typically supplied by ammonium persulfate

• TMED (N,N,N,N-tetramethylethylenediamine)
  serves as a catalyst in the reaction

28
Polyacrylamide Gels

• bis-Acrylamide polymerizes along with acrylamide
  forming cross-links between acrylamide chains

29
Polyacrylamide Gels

• bis-Acrylamide polymerizes along with acrylamide
  forming cross-links between acrylamide chains

30
Polyacrylamide Gels

• Pore size in gels can be varied by varying the
  ratio of acrylamide to bis-acrylamide

• DNA sequencing separations typically use a 191
  acrylamide to bis ratio

Little bis-acrylamide
31
Denaturation of DNA

• For gel electorphoresis to accurately separate on
  the basis of size and not shape or other
  considerations it is important that the DNA be
  denatured
• This is typically achieved by using a high urea
  concentration (8 M) in the gel

32
Separation of FragmentsMaxam-Gilbert
1.2 N NaOH at 90 oC AgtC
Hydrazine TC
Piperidine formate pH 2 GA
Dimethyl sulfate pH 8 G
Hydrazine in 1.5 M NaCl C
5 to 3
X
5GACGTACTTA3
X
G GA TC C AgtC
33
Separation of Sanger Fragments

• Products from 4 reactions each containing a small
  amount of a dideoxynucleotide are loaded onto a
  gel
• Because polymerization goes 5 to 3 shortest
  fragments are 5 compared to longer fragments
  which are in the 3 direction

34
DNA SequencingWhat A SequencingAutorad
ActuallyLooks Like

• To read the autorad it is important to start at
  the bottom and work up so that it is read in the
  5 to 3 direction

5CTAGAGGATCCCCGGGTACCGAGCT...3
35
Sequencing Method Refinements

• Because of difficulties intrinsic to the
  Maxam-Gilbert chemical sequencing strategy,
  efforts at improvement have been concentrated on
  the Sanger method
• Major improvements in the following areas have
  been achieved
• Labeling and detection
• Fragment separation
• DNA Polymerases used in sequencing and resulting
  strategies for generation of fragments
• Automation

36
Pros and Cons of theSanger Method

• It is more amenable to automation than
  Maxam-Gilbert
• Fewer dangerous chemicals are used, but
  acrylamide and P32 or S35 are still a problem
• Gels or autorads are generally cleaner looking
  and the reading of bases is a lot easier than
  Maxam-Gilbert data
• The bottom line Without improvements in
  automation, detection and separation technologies
  Sanger sequencing is still very labor intensive

37
Labeling and Detection

• Labeling using radioactive isotopes is difficult,
  dangerous and expensive
• Using biotin labeled primers has allowed
  conjugation of enzymes to fragments and their
  subsequent detection using substrates that change
  color in the presence of the enzyme
• This technique is clumsy, expensive, time
  consuming and unreliable
• It also may require transfer of fragments to
  membranes thus increasing labor and generally has
  not caught on

38
Labeling and Detection

• Another approach has involved development of very
  sensitive silver staining technologies
• I have tried this one, it is miserable and
  unreliable
• Read length on gels is typically short and
  creation of a permanent copy of the gel requires
  expensive additional equipment and supplies
• It may not involve isotopes, but it is such a
  hassle and the data is of such low quality that
  it is not worth the effort

39
Labeling and Detection

• The most significant advance in labeling has been
  the production of electrophoretically neutral
  dyes that fluoresce at specific wavelengths when
  excited by laser produced light over a very
  narrow range of wavelengths
• These dyes, when attached to primers allow
  detection down to 15 attomoles (10-18)
• Thats less than 107 molecules!

40
The Li-Cor System

• Li-Cor of Lincoln, Nebraska was one of the first
  to implement fluorescent dyes as part of an
  automated sequencing system
• The Li-Cor system uses infrared lasers scanning a
  fixed line toward the bottom of an acrylamide
  slab gel

• Fluorescence of dyes attached to DNA fragments
  are detected as they pass the lasers and
  detectors
• Data in digital form is fed directly into a
  computer system where automated base calling is
  done
• A graphic representation of the data resembles a
  traditional autorad with bands appearing in 4
  lanes

41
The Li-Cor System
A T G C
42
Pros and Cons

• The Li-Cor systems major advantage is the lengths
  of its DNA reads
• Because all fragments travel through the entire
  gel, resolution is sufficient to read over 1,000
  bases in a single run with over 99 accuracy
• This is better than just about any single run
  manual sequencing method
• Elimination of manual reading of autorads also
  eliminates human error and removes a labor
  intensive step
• P32 or S35 not used - another major advantage
• Tricky acrylamide gels still must be cast and
  loaded manually

43
Applied Biosystems

• Applied Biosystems (ABI) has developed
  fluorescent dye systems further and improved
  methods for loading and electrophoresis
• Four dyes each of which fluoresce at a different
  wavelength, but having about the same impact on
  electrophoritic mobility can be used to label
  either primers or the nucleotides that terminate
  a reaction
• If terminator dyes are used, the entire
  sequencing reaction is reduced to one tube from 4
  in conventional Sanger sequencing
• Instead of polyacrylamide slab gels, a single
  capillary can be used with a liquid polymer that
  is replaced after each individual run

44
Replication Using Dye Terminators
3AATAGCATAACGTTAACGTTACGCTAT5
5TTATCG
5TTATCGTA
As the base at the end of each fragment is
clearly marked with a unique fluorescent dye, the
entire reaction can be done in a single tube
5TTATCGTATTGC
5TTATCGTATTGCAATT
5TTATCGTATTGCAATTGCA
45
ABI Prism 310 System

46
The State of the Art

• The ABI Prism 310 (1 capillary), 3100 (16
  capillaries) and 3700 (96 capillaries) represent
  the current state of the art in automated
  sequencing machines
• A single ABI Prism 377 slab gel sequencer can run
  115,000 bases per day!
• The 3100 can run up to 184,000 bases per day
• The 3700 can run up to 1,104,000 bases per day
• Large sequencing facilities, like Celera, have
  factories full of these machines which can run 24
  hours a day with very little down time for
  routine maintenance

47
The State of the Art
48
(No Transcript)