Ch. 19

1
Ch. 19 Eukaryotic Genomes

• 2 challenges of eukaryotic genome expression
• Volume of genome
• 50,000 100,000 genes
• 20 x prokaryote
• Organized around proteins
• Cell specialization
• Lots of DNA do not RNA/ protein
• Gene disruption/placement can lead to cancers

2
Structure of Chromatin

• chromatin structure is based on successive
  levels of DNA packing
• Prokaryotic DNA associated with proteins and
  looped in orderly manner
• Eukaryotic DNA see diagram on next slide and
  pg. 345
• DNA double helix sequence of nucleotides with
  covalent bonds
• histone proteins 50/50 with DNA mass,
  arginine lysine
• Nucleosomes beads
• chromatin - fibers
• looped domains compaction of chromatin in
  mitotic cells
• chromosomes

3
(No Transcript)
4
Genome Organization on the DNA

• Genes are a small portion of the genome (97 does
  NOT code for a protein!!)
• Regulatory sequences
• Lots not understood
• Introns
• Repetitive DNA, some of which is satellite
• Tandem and interspersed
• YOU NEVER HEARD THIS IN BIOLOGY ?

5
Vocabulary

• Introns interrupt coding stretches of DNA and
  are excised from the final mRNA, are not
  expressed as protein, but are within protein
  coding zones
• Tandemly Repetitive DNA present in many, many
  copies, not within genes. In mammals 10-15 of
  the DNA is tandemly repetitive DNA
• GTTACGTTACGTTACGTTACGTTAC
• 10 base pairs
• Repeated up to 100,000 times
• Different density in a centrifuge (banding)
• DNA fingerprinting
• Genetic disorders
• Mostly found at telomeres and centromeres
  suggesting a structural role

6
more

• Interspersed repetitive DNA
• Not harmful
• Does code???
• Lots is found at transposons
• Multigene families
• Genes present in more than one copy per haploid
  set
• Identical or very close nucleotide sequences
• Likely evolved from one ancestral gene
• Clustered or dispersed
• 100-1000 copies of rRNA gene
• Nonidentical sequences can be clustered because
  all parts are need for a particular protein (a
  and b hemoglobin)

7
Errors ????

• Gene families all arose from the same ancestor
  either by duplication, chromosome errors,
  transposons or recombination ---- is it a
  mistake or not a mistake.
• Also regions called pseudogenes that are very
  similar in sequence to functional genes but lack
  regulatory genes or have regions of noncoding DNA

8
(No Transcript)
9
Genetic Disorders

• Huntingtons Disease
• CAG is translated into string of glutamines
• Fragile x syndrome
• Form of mental retardation that is most commonly
  linked to genetic inheritance
• 11500 males, 12500 females
• X chromosome looks different
• More common when fragile x is inherited from
  mother
• Normal allele - 5 region of nontranslating exon
  GGG 30x
• Syndrome allele GGG is repeated 100s 1000s
  x and hang off the end of the X chromosome.
• Triplet repeat disorders
• Affect the nervous system
• Length of sequence impacts both age of onset and
  severity
• Accumulate over generations

10
Genes can be amplified, rearranged or lost
altering a CELLS genome

• Amplification
• Extra copies of genes (like those for RNA) can be
  beneficial in the embryo
• Conversely it is also observed in cancer cells
• Rearrangement
• Transposons regions of DNA that can move from
  one location to anotherposition effects this
  impact.
• 10 of human genome, 50 in some plants
• Retrotransposons move with help of RNA/reverse
  transcriptionase
• Cell differentiation.production of
  immunoglobulins
• Loss

11
(No Transcript)
12
Control of Gene Expression

• Best example see arrangement/rearrangement of
  sequences to create antibodies
• 3-5 of genome expressed at any given moment,
  especially in differentiated/specialized cells of
  multicellular organisms
• Chromatin modifications make DNA available for
  transcription
• DNA methylation genomic imprinting
• Histone acetylation
• Transcription initiation interactions with
  other genes (enzymes)
• Transcription factors, activators, enhancers,
  coordinate control .

13
Lots of big words

• Transcription initiation complex resembles a
  prok promoter by being upstream
• Control elements segments of noncoding DNA that
  regulate transcription by binding transcription
  factors
• Enhancers help bend DNA for transcription
  factors, can be far from gene, even downstream
• Activators help to position the initiation
  complex
• Silencers act like prok repressors, probably
  modify chromatin
• Coordinately controlled genes collections of
  genes, that are related, are usually all
  expressed or all repressed, and are all
  transcribed together, even if they are not near
  on the chromosome.

14
Alternative splicing

• Regulation of gene expression after transcription
• Different mRNA can be produced depending on which
  introns are removed
• mRNA degradation after translation regulates
  amount of a protein produced
• Leader strands on mRNA means it may not all fit
  into ribosomes for immediate translation
• Proteins associated with ribosomes may provide a
  means of control in developing embryos where
  everything is on at once

15
proteases

• Some proteins, like cyclins, need to be degraded
  after they are used..
• Giant proteins called proteases act like
  shredders for this information.
• Mutations in this mechanism may leave some cells
  permanently ON and create cancerous situations.

16
Cancer and Molecular Biology

• Mutagens
• Chemical carcinogens, physical mutagens
• Estimate that viruses are involved in about 15
  of cancers
• 15 of colon and 10 of breast cancer have
  inherited factors
• Have discovered markers for BRCA I and BRCA II
• Oncogenes
• Genes that may cause cancer (trigger cell
  division)
• Proto-oncogenes
• Code for proteins that regulate normal cell
  division
• Tumor suppressor genes
• Genes whose job it is to control unwanted cell
  division