DNA Forensics - PowerPoint PPT Presentation

1 / 16
About This Presentation
Title:

DNA Forensics

Description:

DNA Forensics How DNA is used Ethical Issues By : Daniel DiCenzo – PowerPoint PPT presentation

Number of Views:247
Avg rating:3.0/5.0
Slides: 17
Provided by: Dann1168
Category:
Tags: dna | forensics | lampton

less

Transcript and Presenter's Notes

Title: DNA Forensics


1
DNA Forensics
How DNA is used Ethical Issues
By Daniel DiCenzo
2
What is DNA?
  • DNA - Deoxyribonucleic acid
  • DNA is the blueprint for the design of our bodies
  • Consists of certain base pairs that form specific
    sequences
  • These sequences can code for specific amino acids
  • These amino acids combine
  • to form proteins
  • The proteins together make
  • our entire body
  • Everyones DNA is unique
  • DNA holds all of the information
  • needed to make living things

3
What is DNA used to do?
  • Code for amino acids in our bodies
  • Act as a bar code that identifies who we are (DNA
    Fingerprint)
  • DNA can be analyzed and compared to other DNA
  • Comparing DNA can be used for many purposes
  • To match and analyze peoples DNA, scientists
    must perform special tests

4
What Are These Tests
  • There are many ways to process DNA
  • Polymerase Chain Reaction (PCR)
  • Restriction Fragment Length Polymorphism (RFLP)
  • Short Tandem Repeat (STR)
  • Mitochondrial DNA (mtDNA)
  • DNA is taken from mitochondrion instead of
    nucleus

5
Polymerase Chain Reaction
  • To put it simply PCRs are used to amplify a
    certain piece of DNA
  • The initial piece of DNA is separated into two
    strands
  • RNA primer is attached at specific spot on DNA
  • DNA polymerase adds base pairs to both single
    stranded DNA
  • The product is two identical pieces of double
    stranded DNA
  • This process is repeated many times to achieve a
    large amount of DNA
  • The amount of DNA produced after every cycle
    however increases exponentially
  • This process allows a large amount of DNA to be
    produced from only a minute sample collected

http//campus.queens.edu/faculty/jannr/Genetics/im
ages/dnatech/FG12_11cPCR2.JPG
6
Restriction Fragment Length Polymorphism
  • DNA is cut at specific points into fragments
  • These fragments are then put in a gel
  • Via gel electrophoresis the DNA fragments
    travel across the gel and stop at specific
    distances
  • DNA can be compared to other DNA run through this
    same method
  • This process however requires a large amount of
    DNA sample

http//www.ars.usda.gov/pandp/docs.htm?docid11828

7
Short Tandem Repeat
  • Example of a tandem repeat
  • TAAGCTAAGCTAAGCTAAGC
  • In this tandem repeat TAAGC is repeated four
    times
  • Every persons DNA contains these tandem reapeats
  • These are inherited from your mother and your
    father
  • These are used in identification because they are
    very unique in individuals
  • Scientists analyze 13 loci in our DNA, this
    prevents any doubt that someone else shares these
    same genes
  • If only 2 loci are analyzed the probability that
    someone else shares those genes are much higher
    which is not effective in identifying people
    using DNA

8
What are these fingerprints used for?
  • DNA fingerprinting has many uses
  • DNA fingerprinting has the ability to
  • Prove someone is guilty/innocent of a crime
  • Instantly find the culprit if they are in a DNA
    database
  • Identify unknown bodies (old or new)
  • Determine who the father of a baby is (Paternity
    Test)
  • Find an organ match for a person
  • Catch poachers hunting and selling the meat of
    endangered animals

9
Ethical Issues
  • DNA identification Act (1998)
  • Forces all those in Canada who have been
    convicted of a certain crime to be entered into
    the National DNA Databank (NDDB)
  • This is also the case in the U.S.
  • In 1998, all 50 states used their DNA databank,
    known as the National DNA Index System (NDIS)
  • Having to be forced to provide DNA is a violation
    of human rights, even if you are a criminal
  • Many believe in the future, everyones DNA will
    be on file
  • All of our most valuable secrets are exposed
  • Many believe this is an invasion of privacy
  • Our DNA can predict how we will die, do we want
    that information?

10
Genetic Discrimination
  • DNA holds secret to almost every weakness you
    have
  • By allowing Insurance companies, employers,
    schools or banks access to any illness or flaw
    that you will, may or already have, you can be
    denied instantly
  • Government can learn anything about you without
    your consent
  • Those with Good DNA will be given better
    opportunities and success than those with Bad
    DNA
  • This will lead to a new discrimination, not by
    race or religion, but by your DNA

11
Is DNA fingerprinting Reliable?
  • People have come to believe that DNA evidence is
    indisputable in courtrooms (Too much faith in
    DNA)
  • Human error is always a factor
  • Contamination of evidence
  • Labs are too pressured by police to give them the
    evidence they want to close the case
  • With more strict regulations on the quality of
    labs and technological advances, human error will
    be greatly reduced
  • Planting of evidence is a new problem
  • This always leaves doubt into the reliability of
    DNA evidence
  • Must look for probable cause in a case and not
    rely solely on DNA evidence

12
DNA Databanks
  • There are approximately 200 000 people in the
    Canadian National DNA Databank
  • To this date there have been 10 000 offender hits
    because of this system
  • In the U.S., 6.5 million people have been entered
    into their national DNA databank
  • This databank is the largest in the world and
    has participated in over 77 000 investigations

13
Taken from NDDB statistics page
http//www.nddb-bndg.org/stats_e.htm
14
Taken from NDDB annual report for 2006/2007
http//www.nddb-bndg.org/an_report_e.htm
15
Conclusion
  • DNA holds all of the secrets of our bodies
  • There are many ways that DNA can be used to
    identify and learn about other people
  • It is an effective tool in crime solving
  • The use of DNA databanks has caused major concern
    over the civil rights of convicted felons and
    possibly in the future, the civil rights of
    everyone
  • If peoples DNA is exposed, there is concern for
    our privacy being violated

16
Bibliography
  • Federal Bureau of Investigation. (2008). CODIS
    NDIS Statistics. Retrieved December 9, 2008,
    from http//www.fbi.gov/hq/lab/codis/clickmap.htm
  • Fink, Sheri. (2006, July). Reasonable Doubt.
    Discover, 27(7), 54-59. Retrieved from EBSCO host
    database.
  • Fridell, Ron. (2001). DNA Fingerprinting The
    Ultimate Identity. Toronto Franklin Watts.
  • Genge, N.E. (2002). The Forensic Casebook. New
    York Ballantine Publishing Group.
  • Human Genome Project Information. (2008). DNA
    Forensics. Retrieved November 10, 2008, from
    http//www.ornl.gov/sci/techresources/Human_Genome
    /elsi/forensics.shtml1
  • Lampton, Christopher. (1991). DNA Fingerprinting.
    Boston Christopher Lampton.
  • Learn Genetics. (2008). Can DNA demand a
    verdict?. Retrieved December 1, 2008, from
    http//learn.genetics.utah.edu/content/labs/gel/fo
    rensics/
  • National DNA Databank. (2006). Welcome to the
    National DNA Databank Website. Retrieved November
    20, 2008, from http//www.nddb-bndg.org/main_e.ht
    m
  • Zonderman, Jon. (1990). Beyond the Crime Lab.
    Toronto John Wiley and Sons.
Write a Comment
User Comments (0)
About PowerShow.com