Aucun titre de diapositive

1
Development of a topical formulation containing
lipoplexes able to inhibit E6 and E7 genes for
the treatment of cervix cancer caused by HPV16
and HPV18
Anna Lechanteur1,Tania Furst1 ,Brigitte
Evrard1,Philippe Delvenne2,Pascale Hubert2,
Geraldine Piel1 1Laboratory of Pharmaceutical
Technology-CIRM, 2University of Liege,
GIGA-CANCER, Laboratory of Experimental
Pathology, Liège, Belgium
HPV (16 and 18) are responsible for cervical
cancer, in over 70 of cases. These viruses
integrate into keratinocytes cells and induce the
expression of oncogenes E6 and E7. These prevent
the expression of tumor suppressor genes (p53 and
pRb) and lead keratinocytes transformation into
tumor cells. The purpose of this study is to
target locally mRNA encoding for E6-E7
oncoproteins with siRNA. In order to protect and
to optimize their penetration through the vaginal
mucus and into the cytoplasm, siRNA will be
incorporated into liposomes.
Selection of more efficient siRNA
Selection and formulation of lipids nanoparticules

• selection of simple lipids DOTAP/cholesterol and
  DOTAP/cholesterol/DOPE at different molar ratios
• preparation of cationic liposomes
  dehydration-rehydration method(2)
• measurement of particle size, morphylogy and zeta
  potential

• selected sequences (based on the litterature)
• siRNA E6 (against HPV16) CUAGGCAAACAACUAUACAUGAU
  A
• siRNA E7 (against HPV16) AGGAGGAUGAAAUAGAUGG
• efficiency ( transfection apoptosis) tested
  on
• Cells (SiHa, CaSki, C33A)
• Organotypic culture
• Mice
• toxicity tested on healthy cells
• ? Goal Induce APOPTOSIS without killing healthy
  cells

(1)
Formulation and characterisation of lipoplexes

• The simplest method to prepare siRNA/liposome
  complexes is to mix cationic liposomes with siRNA
  (but different complexation strategies will also
  be tested)
• characterisation of lipoplexes size, zeta
  potential, degree of siRNA encapsulation (ratio
  N/P) and toxicity
• formulation of more specific lipoplex ? with PEG
  (necessary to penetrate into the mucus),
  pH-sensitive lipids (to enhance the endosome
  escape), and characterisation
• in-vitro and in-vivo tests protection of siRNA
  against RNases
• and pH, penetration on organotypic culture,
  evaluation of toxicity on cells,
• escape from the endosome, rate of release,

Development of a sustained release system
containing lipid nanoparticles for intravaginal
delivery
fusion of a lipoplexe with a cell membrane(3)

• Incorporation of lipoplexes in a gel in order to
  improve their contact with the mucosa as well as
  the transfection rate and diffusion through the
  cervical mucus.
• characterisation of lipoplex gel based
  formulation size, integrity, leakage of
  encapsulated material,
• development of lipoplex-gel-based freeze-dried
  rods ? characterisation of obtained sponges
  (morphology, moisture, homogeneity,
  mucoadhesion,) and evaluation of the stablity of
  lyophilized siRNA nanosomes formulations
• tests of rehydration and evaluation of the
  release kinetics.

(1) Scholy C. et al., Journal of Controlled
Release 161, 2012, 554-564 (2) Anup K. Kundu et
al., International Journal of Pharmaceutics 423,
2012, 525-534 (3) Schroeder A. et al., Journal of
Internal Medicine 267-268, 2010, 9-21
T0min freeze-dried sponge
T150min gel after rehydration