A New Breed

1
Interest Grabber
Section 13-1

• A New Breed
• The tomatoes in your salad and the dog in your
  backyard are a result of selective breeding. Over
  thousands of years, humans have developed breeds
  of animals and plants that have desirable
  characteristics. How do breeders predict the
  results of crossing individuals with different
  traits?

2
Interest Grabber continued
Section 13-1
1. Think of two very different breeds of dogs
that are familiar to you. On a sheet of paper,
construct a table that has the following three
heads the name of each of the two dog breeds,
and Cross-Breed. 2. The rows of the table
should be labeled with characteristics found in
both breeds of dogs. Examples might include size,
color, type of coat, intelligence, aggression,
and so on. 3. Fill in the column for each of the
two dog breeds. In the column labeled
Cross-Breed, write in the characteristic you
would expect to see in a cross between the two
breeds you have selected.
3
Section Outline
Section 13-1
131 Changing the Living World A. Selective
Breeding 1. Hybridization 2. Inbreeding B. Increas
ing Variation 1. Producing New Kinds of
Bacteria 2. Producing New Kinds of Plants
Go to Section
4
Concept Map
Section 13-1
Selective Breeding
consists of
which crosses
which crosses
for example
for example
which
which
5
Interest Grabber
Section 13-2
The Smallest Scissors in the World Have you ever
used your word processors Search function? You
can specify a sequence of letters, whether it is
a sentence, a word, or nonsense, and the program
scrolls rapidly through your document, finding
every occurrence of that sequence. How might such
a function be helpful to a molecular biologist
who needs to search DNA for the right place to
divide it into pieces?
6
Interest Grabber continued
Section 13-2
1. Copy the following series of DNA nucleotides
onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTT
AACGTAAGCTACGTTAACCTA 2. Look carefully at the
series, and find this sequence of letters
GTTAAC. It may appear more than once. 3. When
you find it, divide the sequence in half with a
mark of your pencil. You will divide it between
the T and the A. This produces short segments of
DNA. How many occurrences of the sequence GTTAAC
can you find?
7
Section Outline
Section 13-2
132 Manipulating DNA A. The Tools of Molecular
Biology 1. DNA Extraction 2. Cutting
DNA 3. Separating DNA B. Using the DNA
Sequence 1. Reading the Sequence 2. Cutting and
Pasting 3. Making Copies
8
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
9
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
Restriction enzyme EcoRI cuts the DNA into
fragments.
Sticky end
10
Figure 13-6 Gel Electrophoresis
Section 13-2
Power source
DNA plus restriction enzyme
Longer fragments
Shorter fragments
Mixture of DNA fragments
Gel
11
Figure 13-7 DNA Sequencing
Section 13-2
12
Figure 13-8 PCR
Section 13-2
DNA polymerase adds complementary strand
DNA heated to separate strands
DNA fragment to be copied
PCRcycles 1 DNAcopies 1
3 4
4 8
5 etc. 16 etc.
2 2
13
Interest Grabber
Section 13-3
Sneaking In You probably have heard of computer
viruses. Once inside a computer, these programs
follow their original instructions and override
instructions already in the host computer.
Scientists use small packages of DNA to sneak
a new gene into a cell, much as a computer virus
sneaks into a computer.
14
Interest Grabber continued
Section 13-3
1. Computer viruses enter a computer attached to
some other file. What are some ways that a file
can be added to a computers memory? 2. Why
would a person download a virus program? 3. If
scientists want to get some DNA into a cell, such
as a bacterial cell, to what sort of molecule
might they attach the DNA?
15
Section Outline
Section 13-3
133 Cell Transformation A. Transforming
Bacteria B. Transforming Plant Cells C. Transformi
ng Animal Cells
16
Knockout Genes
Section 13-3
Recombinant DNA
Flanking sequences match host
Host Cell DNA
Target gene
Recombinant DNA replaces target gene
Modified Host Cell DNA
17
Figure 13-9 Making Recombinant DNA
Section 13-3
Gene for human growth hormone
Recombinant DNA
Gene for human growth hormone
DNA recombination
Human Cell
Sticky ends
DNA insertion
Bacterial Cell
Bacterial chromosome
Bacterial cell for containing gene for human
growth hormone
Plasmid
18
Figure 13-10 Plant Cell Transformation
Section 13-3
Agrobacterium tumefaciens
Gene to be transferred
Cellular DNA
Inside plant cell, Agrobacterium inserts part of
its DNA into host cell chromosome
Recombinant plasmid
Plant cell colonies
Transformed bacteria introduce plasmids into
plant cells
Complete plant is generated from transformed cell
19
Interest Grabber
Section 13-4
The Good With the Bad The manipulation of DNA
allows scientists to do some interesting things.
Scientists have developed many transgenic
organisms, which are organisms that contain genes
from other organisms. Recently, scientists have
removed a gene for green fluorescent protein from
a jellyfish and tried to insert it into a monkey.

20
Interest Grabber continued
Section 13-4
1. Transgenic animals are often used in
research. What might be the benefit to medical
research of a mouse whose immune system is
genetically altered to mimic some aspect of the
human immune system? 2. Transgenic plants and
animals may have increased value as food sources.
What might happen to native species if transgenic
animals or plants were released into the wild?
21
Section Outline
Section 13-4
134 Applications of Genetic Engineering A. Transg
enic Organisms 1. Transgenic Microorganisms 2. Tra
nsgenic Animals 3. Transgenic Plants B. Cloning
22
Flowchart
Section 13-4
Cloning
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The fused cell begins dividing, becoming an
embryo.
The embryo is implanted into the uterus of a
foster mother.
The embryo develops into a cloned animal.
23
Figure 13-13 Cloning of the First Mammal
Section 13-4
A donor cell is taken from a sheeps udder.
Donor Nucleus
These two cells are fused using an electric shock.
Fused Cell
Egg Cell
The nucleus of the egg cell is removed.
An egg cell is taken from an adult female sheep.
The fused cell begins dividing normally.
Embryo
Cloned Lamb
The embryo is placed in the uterus of a foster
mother.
The embryo develops normally into a lambDolly
Foster Mother
24
Video
Video
Gene Transfer

• Click the image to play the video segment.

25
Internet
Go Online

• Links from the authors on genetically modified
  foods
• Interactive test
• For links on recombinant DNA, go to
  www.SciLinks.org and enter the Web Code as
  follows cbn-4132.
• For links on genetic engineering, go to
  www.SciLinks.org and enter the Web Code as
  follows cbn-4134.

26
Section 1 Answers
Interest Grabber Answers
1. Think of two very different breeds of dogs
that are familiar to you. On a sheet of paper,
construct a table that has the following three
heads the name of each of the two dog breeds,
and Cross-Breed. Encourage students to refer
only to breeds with which they are
familiar. 2. The rows of the table should be
labeled with characteristics found in both breeds
of dogs. Examples might include size, color, type
of coat, intelligence, aggression, and so
on. Additional traits might include shape of
ears, shape of muzzle (pointed or square), or
length of legs with respect to body. 3. Fill in
the column for each of the two dog breeds. In the
column labeled Cross-Breed, write in the
characteristic you would expect to see in a cross
between the two breeds you have
selected. Students will likely assume that
traits of the cross-breed are intermediate
between those of the two parent breeds.
27
Section 2 Answers
Interest Grabber Answers
1. Copy the following series of DNA nucleotides
onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTT
AACGTAAGCTACGTTAACCTA 2. Look carefully at the
series, and find this sequence of letters
GTTAAC. It may appear more than once. 12
Remind students to check their copies for
accuracy before they begin the next step. 3.
When you find it, divide the sequence in half
with a mark of your pencil. You will divide it
between the T and the A. This produces short
segments of DNA. How many occurrences of the
sequence GTTAAC can you find? Students should
find three occurrences of the sequence GTACTAGGT
TAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA
28
Section 3 Answers
Interest Grabber Answers
1. Computer viruses enter a computer attached to
some other file. What are some ways that a file
can be added to a computers memory? A file can
be downloaded from a diskette, a CD, or the
Internet. 2. Why would a person download a virus
program? The computer user would not willingly
download a virus but would download a program
that was useful. 3. If scientists want to get
some DNA into a cell, such as a bacterial cell,
to what sort of molecule might they attach the
DNA? Possible answers a useful protein or a
strand of DNA that the cell would recognize and
accept
29
Section 4 Answers
Interest Grabber Answers
1. Transgenic animals are often used in
research. What might be the benefit to medical
research of a mouse whose immune system is
genetically altered to mimic some aspect of the
human immune system? Students may say that a
mouse with a humanlike immune system would be a
good laboratory model for immune research. 2.
Transgenic plants and animals may have increased
value as food sources. What might happen to
native species if transgenic animals or plants
were released into the wild? Transgenic
organisms might disrupt normal balances in
ecosystems and could breed with natural
populations, changing them.
30
End of Custom Shows

• This slide is intentionally blank.