Title: The Molecular
1 CHAPTER 13
- The Molecular
- Basis of
- Inheritance
2Connection Between Genes DNA
- A)Griffith (1928)
- used pneumonia-causing bacterium
- used 2 strains 1)rough strain - mutant
harmless 2)smooth strain - pathogenic
(disease-causing)
- mixed heat-killed S cells w/R cells
- found that some R cells converted to S cells
- R cells became pathogenic also some chemical
component of the dead cells could pass on
characteristics
Con. 13.1
3- B)Hershey Chase (1952)
- used a virus (much simpler than a cell)
- viruses that infect bacteria used in research are
called bacteriophages - has DNA or RNA enclosed in a protective coat
4- virus reproduces by infecting cell (some use legs
spring action) and take over metabolism - found that DNA of virus is injected into host
cell - injected DNA directs synthesis of more viral DNA
to be made
5(No Transcript)
6Resulting Discoveries
- Griffith discovered transformation - process of
assimilation of external genetic material - inheritable
- identity of the factor causing this was unknown
at that time
- Hershey Chase found bacteriophages better in
research - DNA was genetic rather than protein
- (radioactive elements in 2 different experiments
helped determine this)
7 Nucleic Acids
- Polynucleotides made up of?
nucleotides sugar, phosphate group,
nitrogenous base
-covalent bonding of the sugar of one nucleotide
to a phosphate of another represents the
sugar-phosphate backbone
8DNA/RNA
- phosphate group
- sugar?
- nitrogenous bases?
- phosphate group
- sugar?
- nitrogenous bases?
ribose
deoxyribose
A,U,G,C
A,T,G,C
9Purines - double ring structure (A, G)
Pyrimidines - single ring structure (T, C)
10DNA Structure
- Chargaff - analyzed DNA composition
- and concluded that the quantities of adenine
thymine and quantities of guanine
cytosine,this is known as Chargaffs Rule
Where did Mrs. Doll obtain her masters?
AT GC
11 12- Watson Crick found DNAs structure
- using information from the research
- work of both Rosaland Franklin (X-ray
- crystallography)
- and Irwin Chargaff
- (Chargaffs rule)
- double helix
13- two sugar-phosphate backbones on
- the double helix are oriented in
- opposite directions antiparallel
-
- See page 250
OH
HO
14(No Transcript)
15DNA Replication
Con. 13.2
- Happens when?
- A template mechanism is used to replicate DNA
(make a copy) - template acts as the pattern for the new DNA
(each half of the original DNA serves as the
template) - nucleotides are added 50 per second in mammals
During INTERPHASE S phase
16Origins of Replication
- Origin of replication - site where replication
begins - creates replication bubbles along the strand
- replication will then spread in both directions
along the strand
(see next slide p. 257)
17(No Transcript)
18Strand Separation
Necessary enzymes - helicase unwinds the
double helix - single strand binding proteins
keep strands separated - topoisonmerase
relieves any stress on the strands caused by
the unwinding
19Attaching Nucleotides
- -DNA polymerase catalyzes the synthesis of the
new DNA strands (only starts on the 3 end of
original DNA strand) - DNA is synthesized in a 5 to 3 direction
because the -OH group of the third carbon is
always the one exposed. (The fifth carbon will
have a phosphate attached.)
20Hydroxyl group on the 3 l end
21 Replication fork
DNA polymerase
22The new 5 to 3 strand is called the
leading strand. The new 3 to 5 strand is called
the lagging strand (made in segments 5
to 3 called Okazaki fragments) -DNA ligase links
Okazaki fragments to the growing strand.
Lagging leading
Leading lagging
23What is the overall direction of replication?
3
5
5
5
Leading strand
3
Parental DNA
Lagging strand (Okazaki fragments)
5
3
3
3
5
Overall direction of replication
24Proofreading There is a high accuracy in DNA
replication. Pairing errors between incoming
nucleotides occur 1/100,000 before DNA
polymerase other enzymes correct mistakes.
Afterwards there is only 1/10,000,000,000.
25Repair Maintenance
-Includes proofreading but it must also repair
accidental changes in DNA due to chemicals,
X-rays, UV light, radioactivity -There are more
than 130 types of repair enzymes
26Nucleotide Excision Repair is when an enzyme cuts
out a damaged segment of DNA and gap is filled
w/proper nucleotides by nuclease Telomeres
nucleotide sequences that protect genes during
multiple replication Telomerase catalyzes the
lengthening of telomeres in germ cells
27Con. 13.4 DNA Technology Genomics
28genetic engineering direct manipulation of
genes recombinant DNA nucleotide sequences
from 2 different sources are combined in vitro
into the same DNA molecule biotechnology
mainpulation of organisms to make useful products
29DNA Cloning restriction enzymes (restriction
endonucleases) enzymes that cut DNA at very
specific sites called a restriction site
What puts fragments together?
DNA ligase (forms covalent bonds)
30restriction fragments pieces of DNA strand
sticky end single-strand end of the double
strand
31Using Bacterial Plasmids for Cloning
- cloning vector original plasmid carrying
foreign DNA into a cell - plasmid host DNA are digested w/restriction
enzymes - plasmid cut once, host DNA cut multiple
times - mix plasmid DNA fragments w/ligase
- transformation of foreign DNA occurs
- Transformation means?
32- This combination can now be copied naturally.
- - genes of interest can be identified by other
clones or nucleic acid hybridization (nucleic
acid probe)
33- Recombinant DNA into Eukaryotic Cells
- What to do if you want an entire gene?
- Use YEAST!
- YACs yeast artificial chromosomes
- easy to grow
- have plasmids but are eukaryotic
- carries longer segments of DNA
- fragments
- has organelles capable of modifying proteins
somewhat
34- Electroporation
- short electrical pulse causes temporary holes in
cells plasma membranes so DNA can enter - inject directly into a cell using microscopically
thin needles
35- PCR
- Polymerase Chain Reaction
- good for small amounts or impure DNA
- specific target segments
- 3 steps denaturation, annealing,
- extension
- Why doesnt heat denature everything?
Found heat resistant DNA polymerase in hot
springs bacteria
36 And who benefits from all of our
knowledge of DNA?
37CBS
38How to use DNA
Firstcollect DNA samples to be tested
39Nextuse enzymes to cut DNA segments
Some restriction enzymes will separate a
strand of DNA at very specific locations
based on nitrogen base-pairing sequences.
40Those enzymes will produce segmentsknown as
restriction fragments.
41- ThenGel Electrophoresis sorts DNA
- molecules by size
- fragments can be placed into wells
- in a gel
- 2. electrical current is run through the gel
pulling the strands through the gel 3. DNA
strands have a slightly negative charge and will
move from the negative - electrode end towards the positive
- electrode end of the gel
42The larger the fragment the shorter the distance
it will travel because it gets caught in the gel.
(Which fragment was the largest?)
(Which ends would the positive and negative
electrodes be located?)
Wells
43Finallythe gel is read to determine if the
samples being tested are matches
Can compare different DNA samples against each
other (down to 1 base pair)
44- Southern Blotting
- combines gel electrophoresis nucleic acid
hybridization - radioactive probe is complementary to the gene of
interest
45DNA Sequencing Dideoxy Chain-Termination
Method Equals Super Computer!
46RFLPs (restriction fragment length
polymorphisms) Say rif-lips
Not jokingthis is how you say it!!
- homologous chromosomes have differences in their
restriction sites that give different fragment
patterns - Serve as genetic markers
47(No Transcript)
48Chapter 14 From Gene to Protein Genes do not
build proteins directly but give instructions in
the form of RNA (RNA programs protein synthesis)
49Genotype to Proteins
Transcription - genetic info must first Be
transferred from DNA into RNA Translation -
info in RNA must be transferred into a protein
Con. 14.1
50 Transcription
Translation
51The genetic code, instructions for building a
protein, is written in a series of 3 mRNA
nitrogen bases called a codon or triplet
code. - 64 possible codons (43) - each
codon corresponds to an amino acid or
start/stop signals - start is AUG (also codes
for met) and stop is UAA, UAG, UGA -
genetic code is the same for all organisms
w/a few exceptions
52p. 273
53Transcription
Con. 14.2
- 1. Initiation
- a. genetic information in DNA is transcribed
(message has just been rewritten) in RNA - b. RNA molecules are made from DNA templates
(similar to DNA replication but only 1 original
strand serves as a template)
54DNA
55(No Transcript)
565l 3l
c. new strand grows in what direction? d.
ribonucleotides make up the RNA strand (similar
to DNA nucleotides w/same base pairing rules)
RNA UACGGU DNA ATGCCA Why is there U?
Uracil replaces Thymine
57What linked DNA nucleotides together? So what
links RNA?
DNA polymerase
RNA polymerase
e. RNA polymerase links the ribonucleotides
together f. RNA polymerase needs a promoter-
sequence of nucleotides on the DNA strand to
initiate the process transcription unit section
of DNA that is transcribed into mRNA
58g. transcription factors collection of proteins
help RNA polymerase bind start
transcription Promoter Transcription Factors
RNA polymerase transcription initiation complex
592. Elongation a. RNA peels away from DNA DNA
comes back together b. growth of the
new strand continues until RNA polymerase
reaches the terminator sequence
What are the possible terminator sequences?
UAA, UAG, UGA
60RNA
Template Strand
613. Termination a. polyadenylation signal
sequence is identified (AAUAAA) so mRNA is
cut b. new mRNA must now move So where
does transcription take place?
- Occurs in the nucleus then moves into the
cytoplasm (this is where ribosomes make protein)
62Modification after Transcription in Eukaryotes
- Before mRNA leaves the nucleus it receives a
5cap (a single G nucleotide) - poly-A tail (50
to 250 As) to protect it from attack by enzymes
in the cytoplasm. The cap and tail do not code
for amino acids.
Con. 14.3
63Eukaryotic DNA Introns-internal noncoding
regions Exons-parts of a gene expressed as
amino acids -Both are transcribed into RNA, but
introns are removed (RNA splicing) prior to the
mRNA leaving the nucleus. -Exons then join to
form one continuous coding sequence (spliceosome)
64(No Transcript)
653 Kinds of RNA
Con. 14.4
1) Messenger RNA (mRNA) - encodes amino acid
sequence that is transcribed DNA - The
genetic message it carries is translated
into polypeptides
2)Transfer RNA (tRNA) - serves as an
interpreter between nucleic acids and
proteins - Brings in appropriate amino acids
to make polypeptides
66 - tRNA is single stranded
- and folded into a shape
- similar to a cloverleaf
Amino Acid attachment site
67tRNA has 2 special attachment sites -site
where aa is picked up -site where mRNA is
recognized by the anticodon (set of 3 bases
which recognize complementary bases on
the mRNA codon)
683)Ribosomal RNA (rRNA) - found on the
ribosomes (structural component) -helps read
mRNA code and delivers the proper tRNA
69The Actual Ribosome
Made of 2 subunits. Each one is made up of
proteins (40) and rRNA (60). These coordinate
the binding of mRNA plus 2 binding sites for
tRNA. - P site holds tRNA strand carrying
the growing polypeptide - A site holds tRNA
carrying the next amino acid to be added on
- E site discharges tRNA from ribosome
70Simplified Version
71Translation - Making Proteins
Protein Synthesis - 3 stages
- Initiation - brings together mRNA
- codon w/tRNA anticodon (view)
- 2. Elongation - when more amino acids
- are added on, one by one
- -peptide bonds form between aas
- 3. Termination - when termination
- codon reaches A site of ribosome
- -protein is typically 100 aa long
- -protein release factor helps to
- free new polypeptide
72(No Transcript)
73SUMMARY DNA Non-template ATGTATACCCCGTACGTGTAA
Template TACATATGGGGCATGCACATT mRNA
AUGUAUACCCCGUACGUGUAA
AUG anticodon codon
tRNA
amino acid
74(No Transcript)
75Mutations
Con. 14.5
- changing the meaning of genes
- any change in the nucleotide sequence (either
large chromosome regions or single DNA base
pairs) - Point Mutations - changes in single DNA base
pairs - - 2 types
76 1. Base Substitutions - replacement of one
nucleotide w/another (can result no change or
change crucial to life) 2. Base Insertions or
Deletions - can change reading frame of codons
(nucleotide triplets) called frameshift
mutations
77(No Transcript)
78Mutagenesis
- process of creating mutations
- 2 causes
- 1. Spontaneous Mutations - errors made during DNA
replication or recombination - 2. Mutagen - physical or chemical agent that
causes mutation (X-rays, UV, tobacco)
79Chapter 15
- Regulation of Gene Expression
80Gene Expression flow of information from genes
to protein (genotype to phenotype
- Metabolic Control of Bacteria
- Adjust activity level of enzymes already present
(feedback inhibition) - Regulate the expression of genes encoding enzymes
Con. 15.1
81Molecules Needed for Gene Expression
- promoter site just prior to gene(s) where RNA
polymerase attaches - operator between promoter gene that acts as a
switch - operon promoter operator genes being
controlled - - entire stretch of DNA required for
- enzyme production
82- repressor protein, when active, that can turn
off an operon by binding to the operator
blocking the attachment of RNA polymerase - works like a reversible competitive inhibitor
- allosteric protein (2 alternative shapes, active
inactive) - NOTE prime control on prokaryote gene expression
83Negative Gene Expression- operons are switched
off by the active form of repressor protein
- Repressible Operon
- trp operon usually turned on but can be inhibited
- makes tryptophan
- Inducible Operon
- lac operon usually turned off but induced by a
chemical signal - breaks down lactose
84- Positive Gene Expression
- regulatory protein, catabolite activator protein
(CAP), interacts directly with genome to switch
transcription on - activator protein that assists RNA polymerase
in binding to promoter - - lac operon works using both negative positive
control
85(No Transcript)
86Eukaryotic Gene Expression
cell differentiation cell expresses different
genes but contains all genes - must code for the
right sequence at the right time
Con. 15.2
87- Chromatin Modifications
- a. Histone Acetylation acetyl groups attached
to lysine neutralize charges allowing for space
between histones - b. DNA Methylation methylated bases
inactivate expression (this can be genetic)
88 Epigenetic Inheritance
892.Transcription Initiation How many molecules or
parts of molecules does it take to start
transcription? p. 301
- transcription initiation complex
- enhancers groups of control elements (segments
of noncoding DNA both proximal distal) - mediator proteins
- repressors if needed
90Coordination of expressed genes not operons
located closely together but genes located on
different chromosomes
91- Translation
- a. alternative RNA splicing same mRNA spliced
different ways (introns exons sections are
different) -
- b. mRNA Degradation how long mRNA can stay in
cytoplasm before broken down - - determines how many times it goes through
translation
92 c. tagging proteins ubiquitin attaches to
protein - proteasomes recognize tag destroy