DNA, RNA and Proteins

1
DNA, RNA and Proteins
2
12-1 The Structure of DNA

• What is genetic material composed of?
• What experiments helped to identify the role of
  DNA?
• What is the shape of a DNA molecule?
• How is information organized in a DNA molecule?
• What scientific investigations led to the
  discovery of DNAs structure?

3
Structure of DNA

• People have historically had an interest in
  heredity
• Mendel suggested parents physically gave traits
  to offspring in early 1800s
• Discovered mitosis and meiosis in late 1800s
• 1950s knew chromosomes where made of DNA
• DNAs structure (and importance) was discovered
  in 1953.
• Human genome work done in 2004.

4
DNA The Genetic Material

• DNA is the primary material that causes inherited
  traits.
• DNA is a fairly simple chemical compound
• DNA stands for deoxyribonucleic acid
• It contains ribose sugar, phosphate and 4 bases
• Chromosomes are made of DNA and protein
• DNA codes for how to make proteins
• Proteins are responsible for the traits (growth
  hormone for tallness and antigens for type A
  blood are both proteins)

5
Discovery of DNA

• Three experiments suggested and proved that DNA
  was the molecule that carried information between
  cells
• Fredrick Griffith worked with bacteria in mice
  (1928)
• See page 294
• Griffith discovered Bacterial Transformation

6

• Oswald Avery worked with bacteria (1940s)
• Transformation caused by DNA for specific protein
• Alfred Hershey and Martha Chase worked with
  bacteria and viruses called phages.(1952)

7
Summary of Experiments

• Griffith found that
• Bacteria can trade information and learn how
  to make new proteins
• Avery found that
• It is the DNA that tells the bacteria cells how
  to make the new proteins ( for the capsule that
  caused the deadly form of bacteria)
• Hershey and Chase found that
• If you trace DNA from a virus it goes into the
  infected bacteria cells. But the protein from the
  virus does not enter the infected cell.
• DNA transmits the information about how to make a
  protein
• DNA can move between cells

8
Shape of DNA

• James Watson and Francis Crick discovered
• 1953, at Cambridge University
• Knowing structure allowed them to figure out how
  it does its job
• Code is linear (along the length, spelled with
  4 bases ATCG)
• It can open up to make copies
• Shape is called a double helix

9
Part of the DNA strand

• Back bone of double helix is a sugar
  (deoxyribose) and phosphate strand
• strong covalent bonds.
• S (sugar)-P-S-P-S-P..
• P is phosphate PO4 -3
• Nitrogenous bases make up the rungs that hold
  the backbones of the helix together.
• Adenine(A), guanine(G), cytosine(C) and thymine
  (T)
• A bonds to T and C bonds to G using Hydrogen
  bonds
• DNA splits open between bases during replication

10
Information on DNA

• The linear sequence of bases is THE CODE
• Pattern of ATC and G along the length of the
  double helix codes for how to make all of the
  proteins needed to build and to run cells
  (organisms)
• One side of the helix is the actual information.
  The other side is complementary - actually
  its the opposite. (A-T and C-G)

11
What Watson and Crick Discovered

• Pattern
• Used data from E. Chargaff to build model with A
  across from T and C across from G
• 2. Technology
• M. Wilkins and R. Franklin showed them how to
  take x-ray crystallography (pictures) of the DNA
  strand coils
• 3. Model
• built a 3-D model to help decide
  research/hypothesis and noticed that the model
  was the answer.
• 4. Published famous paper
• in journal called Nature in 1953
• 5. Received Nobel Prize
• 1962

12
13-2 Replication of DNA

• How does DNA replicate or make a copy of itself?
• What are the roles of proteins in DNA
  replication?
• How is DNA replication different in prokaryotes
  and eukaryotes?

13
DNA Replication

• A dividing cell makes an exact copy of the DNA
  information in its nucleus before it divides
• Short version (during S portion of Interphase)
• DNA double helix unzips
• Right side makes a new left half
• Left side makes a new right half
• 2 new, identical, complete copies

14
Semi-conservative Replication

• See pic. on pg 301 know this process

• The detailed version ?

1. Enzymes cause helix to unwind Enzyme
called helicase ( all enzymes end in ase)
Split is called replication fork (Y shape)
Direction of copying is antiparallel one strand
copies top to bottom, other - from bottom toward
top
2. Complementary bases are added to the exposed
bases A to T and C to G Bases are
available from diet, in the nucleoplasm
Spontaneous hydrogen bonds
3. As bases are added helix reseals and twists
Enzyme that adds bases is called DNA polymerase
4. Proof reading of DNA occurs using yet another
enzyme One mistake per billion nucleotides
5. These enzymes are proteins that were coded for
by DNA!
15
Prokaryotes vs. Eukaryotes

• DNA is packaged into chromosomes
• Prokaryotes have 1
• Eukaryotes have many
• Regions of chromosomes that code for a protein
  are called genes
• Other
• Smallest euk. chromo is 10x prok. Chromo
• All human chromosome information stretch out 2
  meters
• Bacteria would only be 0.25 cm
• Human would take 33 days to copy starting at only
  one point.
• Prokaryotes
• Replication of the one chromosome starts at a
  single point.
• Eukaryotes
• DNA coiled around protein threads called histones
• Replication starts at many points and goes in
  both directions
• Occurs faster since theres so much more to copy
  (only 8 hrs.)

16
DNA Transcription RNA Translation Protein synthesis
Actual directions chemical, found in the nucleus can not leave Making a copy DNA ? RNA Edit to mRNA Copy of the directions, able to go to ribosomes Reading the directions on mRNA to make a protein Finishing protein beyond putting aa together, fold and package
Cook book Each recipe is a gene, each family has their own versions Copying recipe to recipe card or emailing to a friend Recipe on recipe card/ email arriving at friends house Following recipe at a friends house, from card or email Not just mixing the cookie dough, but baking/cooling/putting in bags/etc and doing the dishes
Encyclopedia set - that can not leave library entire wikipedia information Photocopy of one entry Look up fact You, taking the photocopy/print out of library/ home You use information from this print out to put together paragraphs for a report The actual finished report that you hand in
All the possible soccer plays known The actual route your team decides to use to pass The fact that the players know their positions for the throwing Completing the throw in Adding that throw in to other moves to score a goal
17
Transcription

• Copying DNA information onto RNA
• DNA can not leave nucleus
• Proteins are made at ribosomes, out in the
  cytoplasm either free or attached to rER
• DNA opens and one side is read and a copy is
  made
• Can make multiple copies, send to lots of
  ribosomes, make lots of protein at once
• RNA is edited and the final version, mRNA leaves
  the nucleus, carrying the message

18
Translation

• mRNA is decoded by the ribosome
• The right amino acids placed in the right order
  to make a protein.
• Code is 300-400 bases long
• Read in groups of three called codons
• Codon piece of code
• This equals 100 amino acids
• Right amino acids bonded, using peptide bonds
  polypeptide completed, folded polypeptide
  protein.
• Everything in your body is a protein or is
  regulated and controlled by a protein!

19
Protein synthesis

• Complete process
• Read DNA code
• Assemble amino acids in order
• Fold and process polypeptide
• Have a functional protein
• Transcription Translation Processing

20
Translate and transcribe the following
information into an amino acid sequence

• GAAAATATCATCTATGGTGGTGTTTAA