In the Name of Allah God, The Most Gracious, the Most Merciful

1
In the Name of Allah (God), The Most Gracious,
the Most Merciful
2
Miracles of Knowledge Found in The Noble Quran
and The Teachings of Prophet Mohammad Peace Be
Upon Him

• Dr. Zaid Kasim Ghazzawi
• Ph.D. in Biomedical Engineering
• University of Surrey England
• E-mail zaidquran_at_yahoo.com
• Website www.quran-miracle.com

3
Islams View on Christianity

• Topics to be addressed
• The authenticity of the Quran and the Bible in
  the light of science.
• Jesus peace be upon him in Islam and
  Christianity.
• The day of Resurrection from an Islamic and
  Christian perspective.
• Dr. Zaid Kasim Ghazzawi

4
Part Two

• Jesus peace be upon him in Islam and Christianity

5
Jesus (PBUH) in Islam

• An article of faith for a Muslim to believe in
  Jesus peace be upon him
• A prophet of God (Allah) all Mighty
• Birth of Jesus (pbuh) a word Allah (God)
  bestowed upon Mary peace be upon her.
• The Injeel was the revelation given to Jesus
  (pbuh)
• Preached pure monotheism to worship Allah (God)
  all Mighty.

6
The Description of Jesus PBUH in the Noble Quran
7
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
O people of the Scripture (Jews and Christians)!
Do not exceed the limits in your religion, nor
say of Allah (God) Almighty aught but the
truth. The Messiah 'Iesa (Jesus), son of Maryam
(Mary), was (no more than) a Messenger of Allah
(God) and His Word, ("Be!" - and he was) which He
bestowed on Maryam (Mary) and a spirit (Rûh)
created by Him so believe in Allâh and His
Messengers. Say not "Three (trinity)!" Cease!
(it is) better for you. For Allâh is (the only)
One Ilâh (God), Glory be to Him (Far Exalted is
He) above having a son. To Him belongs all that
is in the heavens and all that is in the
earth. And Allâh is AllSufficient as a Disposer
of affairs
The Noble Quran (4 171)
8
The Description of Jesus Peace be Upon Him in The
Noble Quran
9
A Logical Argument and Historical Facts which
testify to the fact that Jesus PBUH is a
messenger of Allah (God) Almighty and nothing
more
10
Allahs (God) Almighty Infinite Mercy to Mankind
7. Allah (God) Almighty has encompassed
everything in mercy and knowledge
The Noble Quran (40 7)
Mercy requires that Allah (God) Almighty should
send messengers to guide people and these
messengers should be 100 man and nothing more,
why?
Because if the messenger is more than a man then
people can not relate to him
For example how can the messenger teach you about
patience when enduring pain if he was more than a
man?
11
Allahs infinite mercy to mankind
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
The Noble Quran (3543)

• 43. So no change will you find in Allah's
  (God) Almighty Sunnah (way of dealing), and no
  turning off will you find in Allah's Sunnah (way
  of dealing)

12
Jesus peace be upon him in Islam

• Article of faith for a Muslim to believe in Jesus
  
• (PBUH) as a prophet
• 2. As a prophet of God (Allah) all Mighty

13
(No Transcript)
14

• The Message of Islam
• - Universal message
• Continuing Miracle of the
• Noble Quran

Miracle to support the Revelation in this day and
age The superiority of the Noble Quran with
regards to knowledge
15
It is illogical to think of Jesus (pbuh) to be
more than a prophet

• It is against the Sunnah (Way) of Allah (God) all
  Mighty throughout the ages.
• People cant relate to Jesus (pbuh)
• If he feels pain (does he really ?)
• How could he teach people about patience?
• Prophet Job (pbuh) endured 18 years of illness,
  why?

16
Jesus peace be upon him in Islam

• 1. Article of faith for a Muslim to believe in
  Jesus (pbuh) as a prophet
• 2. As a prophet of God (Allah) all Mighty
• 3. Birth of Jesus (pbuh) a word Allah bestowed
  upon Mary

17
The birth of Jesus (pbuh) in Islam A Word Allah
bestowed upon Mary
18
In The Name of Allah (God) The Most Compassionate
The Most Merciful
And (remember) when the angels said "O Maryam
(Mary)! Verily, Allâh has chosen you, purified
you (from polytheism and disbelief), and chosen
you above the women of the 'Alamîn (mankind and
jinns) (of her lifetime)." O Mary! "Submit
yourself with obedience to your Lord (Allâh, by
worshipping none but Him Alone) and prostrate
yourself, and Irkâ'i (bow down etc.) along with
Ar-Râki'ûn (those who bow down etc.)."
The Noble Quran (3 42-43)
19
In The Name of Allah (God) The Most Compassionate
The Most Merciful
(Remember) when the angels said "O Maryam
(Mary)! Verily, Allah (God) gives you the glad
tidings of a Word "Be!" - and he was! i.e. 'Iesa
(Jesus) the son of Maryam (Mary) from Him, his
name will be the Messiah 'Iesa (Jesus), the son
of Maryam (Mary), held in honour in this world
and in the Hereafter, and will be one of those
who are near to Allah (God)"
The Noble Quran (3 45)
20
In The Name of Allah (God) The Most Compassionate
The Most Merciful
She said "O my Lord! How shall I have a son when
no man has touched me." He said "So (it will be)
for Allah (God) creates what He wills. When He
has decreed something, He says to it only "Be!"
and it is.
The Noble Quran (3 47)
21
How was Jesus peace be upon Him created from a
scientific point of view?

• The answer can be found in the Noble Quran

22
The Answer can be Found in The Noble Quran (3
59)

• Which states the Perfect Correlation between the
  Creation of Adam and that of Jesus Peace be upon
  Him

23
In The Name of Allah (God) The Most Compassionate
The Most Merciful
Verily, the likeness of 'Iesa (Jesus) before
Allah (God) is the likeness of Adam. He created
him from dust, then (He) said to him "Be!" - and
he was
The Noble Quran (3 59)
Stages involved in the creation of Adam peace be
upon Him
Stages involved in the creation of Jesus peace be
upon Him
Since Allah (God) Almighty states that He created
Jesus peace be upon Him exactly like Adam. Thus
the components comprising the body of Jesus peace
be upon Him should be found in the Soil.
Allah (God) Almighty created Him from the Soil,
which indicates that the components comprising
the physical body of Adam peace be upon Him are
to be found in the soil
24
Analysis of Elements Found in The Soil

• Iodine (I)
• Ferrous (Fe)
• Copper (Cu)
• Silicon (Si)

• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)
• Calcium (Ca)
• Phosphorus (P)
• Potassium (K)
• Sulfur (S)
• Sodium (Na)
• Chlorine (Cl)
• Magnesium (Mg)

25
Elements Comprising The Basic Building Blocks of
the Human Body (i.e. Amino Acids)

• Elements Comprising Amino Acids
• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)

• Elements in The Soil
• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)

http//www.chemie.fu-berlin.de/chemistry/bio/amino
-acids_en.html
26
The Use of the Elements Found in The Soil In the
Physiological Functions of The Human Body

• Sodium (Na) and Potassium (K) are used in the
  transmission of neural signals
• Calcium (Ca) is used in cell signaling and muscle
  function
• Ferrous (Fe) is used in mass bio-transport in the
  human body
• Phosphorus (P) is used in the construction of
  bone material
• Iodine (I) is needed for healthy functioning of
  glands
• Chlorine (Cl) is used to maintain fluids balance
• Copper (Cu) is used in the transmission of
  electrical signals
• Silicon (Si) is a constructional material in the
  human body
• Sulfur (S) is used in muscular proteins
• Magnesium (Mg) is used in the construction of
  bone material

27

• Constructional Material (Amino Acids)
• Hydrogen (H)
• Nitrogen (N)
• Oxygen (O)
• Carbon (C)
• Functional Material
• Calcium (Ca)
• Phosphorus (P)
• Potassium (K)
• Sulfur (S)
• Sodium (Na)
• Chlorine (Cl)
• Magnesium (Mg)
• Iodine (I)
• Ferrous (Fe)
• Copper (Cu)
• Silicon (Si)

Perfect correlation between the elements found in
the soil and those found in the human body
28
Perfect Correlation between the Creation of Adam
and Jesus Peace Be Upon Them
Jesus peace be upon Him was created from the
components found in the body of Mary peace be
upon Her
Adam peace be upon Him was created from the
components comprising the soil
And since the components found in the body of
Mary peace be upon Her are the same as in the
Soil (as the case of every human), then Jesus
peace be upon Him is created from the soil as
Allah (God) Almighty states in the Noble Quran
29
Stages involved in the creation of Adam peace be
upon Him
Stages involved in the creation of Jesus peace be
upon Him
Allah (God) Almighty created Him from the Soil,
which indicates that the components comprising
the physical body of Adam peace be upon Him are
to be found in the soil
Since Allah (God) Almighty states that He created
Jesus peace be upon Him exactly like Adam. Thus
the components comprising the body of Jesus peace
be upon Him should be found in the Soil.
Then Allah (God) Almighty said to Adam peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Adam peace be upon him
Then Allah (God) Almighty said to Jesus peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Jesus peace be upon him
30
How is Jesus PBUH and Adam PBUH A Word from Allah
(God) Almighty?

• As viewed from a scientific point of view

31
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
And you see the mountains and think them solid
without movement, but they pass away as the
passing away of the clouds. The manufacturing of
Allah (God) Almighty, Who perfected all things,
verily! He is Well-Acquainted with what you do
The Noble Quran (27 88)
The Mountains
A created being of Allah (God) Almighty
Allah (God) Almighty describes that it is created
by a process of manufacturing
And a manufactured product needs instructions
(words) on how the components need to be
assembled
32
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
In whatever form Allah (God) Almighty willed He
assembled you together
The Noble Quran (82 8)
Allah (God) Almighty describes that the human
body is made in a process of assembly
Thus there is a need for the information which
describes the sequence and number of the basic
units to be assembled
This information is the word of Allah (God)
Almighty for creation (Be and it is)
33
The word of Allah (God) Almighty for creation is
found in the DNA molecule

• Storing information using a geometric code

34
DNA molecule
Tortora and Grabowski, 1996
35
(No Transcript)
36
In The Name of Allah (God) The Most Compassionate
The Most Merciful
And Allah (God) has grown you from the earth like
plants Then He will return you in it (i.e.
earth) and bring you forth (on the Day of
Judgment)
The Noble Quran (71 17-18)
37
Amino acids
http//www.chemie.fu-berlin.de/chemistry/bio/amino
-acids_en.html
38
Every three geometrical units codes for one amino
acid
DNA Molecule
Amino Acids
39
The word for the creation of collagen protein
(Storing of Information using a geometrical code)

Assembly of amino acids in a specific type,
number, and sequence to create proteins
40
The Manufacturing of Proteins within the Human
Body
41
Collagen type V sequenceThe Word of Allah (God)
Almighty to create The Collagen Protein
Start codon

• AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGGGCCCATCTGGCCCACGT
  CTCCTGTCTCGCCCTTTTCTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
  ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAACCTTCATCTCCTTTC
  TGCCCAAACAGGCCCTGCTGTCCACGAGGGCCAGGTTCACCATCTGCTCC
  CG AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGACCGGTAGGCCCAGG
  AGGACCCTGCTCGCCTTTGTCGCCCTTGCTTCCCTTCTGCCCTGGCTCTC
  CGATC

42
The production of collagen proteins within the
human body
???? ?????????
Tortora and Grabowski, 1996
43
Sequence for Elastin Molecule The Word of Allah
(God) Almighty to create The Elastin Protein

• 1 gagtcctccc cgagatggcg ggtctgacag cggtagtccc
  gcagcctggc gtcttgctga 61 tcctcttgct caacctcctc
  catcccgcgc agcctggagg ggttccagga gctgtgcctg 121
  gcggacttcc tggtggagtt cccggtggag tctattatcc
  aggggctggt attggaggcc 181 tgggaggagg aggaggagct
  ctgggacctg gaggaaaacc acctaagcca ggtgccggac 241
  ttctgggaac gtttggagca ggtcctggag gacttggagg
  tgctggcccg ggtgcaggtc 301 tcggggcctt tcctgcaggc
  accttcccag gggcaggagc tctggtgccc gggggagcag 361
  caggggctgc tgcggcttat aaagctgccg ccaaagctgg
  ggctgggctt ggtggcgttg 421 gcggagtccc aggtggtgtt
  ggcgttggtg gagttccagg tggtgttgga gttggcggag 481
  tcccaggtgg tgttggagtt ggtggagtcc ctggcggtgt
  tggtggtatt ggtggcatcg 541 gtggcttagg agtctcgaca
  ggtgctgtgg tgccccaagt cggagctggc atcggagctg 601
  gaggaaagcc tgggaaagtt cctggtgttg gtcttccagg
  tgtataccca ggcggagtgc 661 tcccaggaac aggagctcgg
  ttccctggtg tgggggtgct ccctggagtt cccactggca 721
  caggagtcaa agccaaggct ccaggtggag gtggtgcttt
  tgctggaatc ccaggggtcg 781 gaccctttgg gggtcagcag
  cctggtgtcc cactgggtta tcccatcaaa gcaccaaagc 841
  tgccaggtgg ctacggactg ccctatacca atgggaaatt
  gccctatgga gtagctggtg 901 cagggggcaa ggctggctac
  ccaacaggga caggggtcgg atcccaggcg gcggcggcag 961
  cagctaaagc agccaagtat ggtgctgggg gagctggagt
  cctccctggt gttggagggg 1021 gtggcattcc tggtggtgct
  ggcgcaattc ctgggattgg aggcattgca ggcgctggaa 1081
  ctcctgcagc agcagctgct gcaaaggctg ctgctaaggc
  tgctaagtat ggagctgctg 1141 gaggtttagt gcctggtgga
  ccaggagtta ggctcccagg tgctggaatc ccaggtgttg 1201
  gtggcattcc tggtgttggt ggcatcccag gtgttggggg
  ccctggtatt ggaggtccag 1261 gcattgtggg tggaccagga
  gctgtgtcac cagctgcagc tgctaaagct gctgccaaag 1321
  ctgccaaata cggagccaga ggtggagttg gcatcccgac
  atatggggtt ggtgctggtg 1381 gctttcctgg ctatggtgtt
  ggagctggag caggacttgg aggtgcaagc ccagctgctg 1441
  ctgctgccgc cgccaaagct gctaagtatg gtgctggagg
  agctggagcc ctgggaggcc 1501 tggtgccagg tgcagtacca
  ggtgcactgc caggtgcagt accagctgtg ccgggagctg 1561
  gtggagtgcc aggagcaggt acccctgcag ctgcagctgc
  tgccgccgcc gctaaagcag 1621 ccgccaaagc aggtttgggt
  cctggtgttg gtggggttcc tggtggagtt ggtgttggtg 1681
  ggattcccgg tggagttggt gttggtgggg ttcctggtgg
  agttggccct ggtggtgtta 1741 ctggtattgg agctggtcct
  ggcggtcttg gaggagcagg gtcaccggct gccgctaaat 1801
  ctgctgctaa ggcagctgcc aaagcccagt acagagctgc
  cgctgggctt ggagctggtg 1861 tccctggatt tggggctggt
  gctggtgtcc ccggatttgg ggctggtgct ggtgtccccg 1921
  gatttggggc tggtgctggt gtccccggat ttggggctgg
  tgctggtgtc cctggatttg 1981 gagctggagc agtacctgga
  tcgctggctg catccaaagc tgctaaatat ggagcagcag 2041
  gtggccttgg tggccctgga ggtctcggtg gccctggagg
  tctcggtgga cctggaggac 2101 ttggtggggc tggtgttccc
  ggtagagtag caggagctgc accccctgct gctgccgctg 2161
  ctgctgccaa agctgctgct aaggctgccc agtatggcct
  tggtggagcc ggaggattgg 2221 gagccggtgg actgggggcc
  ggtggactgg gagccggtgg actgggagct ggtggactgg 2281
  gagccggtgg actgggagct ggtggactgg gagccggtgg
  actgggagct ggtggaggtg 2341 tgtcccctgc tgcagctgct
  aaggcagcca aatatggtgc tgctggcctt ggaggtgtcc 2401
  taggagccag gccattccca ggtggaggag ttgcagcaag
  acctggcttt ggactttctc 2461 ccatttatcc aggtggtggt
  gctgggggcc tgggagttgg tggaaaaccc ccgaagccct 2521
  atggaggagc ccttggagcc ctgggatacc aaggtggggg
  ctgctttggg aaatcctgtg 2581 gccggaagag aaagtgatct
  tctggggacc cctgactcgc gacctcatca acgttggtgc 2641
  tactgcttgg tggagaatgt aaaccttcta tgaccacccc
  ctcctccatc cccctgaccc 2701 ccacctggga ggggacaaca
  ggccagtggc cttggaaacc cacaggacaa ggaaatcaga 2761
  cagcagcagc catgcagccc taaccagaaa ctccccccac
  cctatatcag aggccagggc 2821 gggtgtccca tctcttccca
  cccaggagct cccccccaca gtctccatct ccaagggaaa 2881
  ttggtgctac atgttggtgc ttcttctttg tggggggagg
  gaggagggaa gggtatccca 2941 ggggggattg cccccttccc
  tgaagcccct ctattaagat ggtgcacacc tttgttgggc 3001
  agtcccacct ccccctgccc accaggagcc attcctggct
  gcatcccatt ggtacccaaa 3061 taccggaagc cttgacgatg
  gatttggtga catgatccct ctctctttgg ttcccctgtc 3121
  cctgcctcct gttacctaaa gctacttccc acatctggga
  caccctggag tcagatggct 3181 cctcacactg ggaatagctc
  ccttgttctt atggaatcca cctgccatcc acccatccac 3241
  ctactcatcc atccatccat ccatccatcc atccgtccat
  cttgactgcc tagtaccact 3301 aagctggctg ggcataccca
  ctatcaacct ggttcacctg tcatggcagc ctgtccccgt 3361
  ccccaccaca caccccgatc ctggcctagg gtgcaaaggg
  ttgtgtgggc tggttgtccc 3421 cacatgcagt actgtaaccc
  cgttcttcct ggagccactc ttacagagca tgtctcacca 3481
  ccccacctct ttgtgtttcg ctgtgataga tcaataaaat
  attttatttt ttgtcctgga 3541 tatttgggga tgatgtttga
  ttgttggtgt gctctttggg tttatttttg tggctaattg 3601
  gggagagaga gagagaaaaa aaaatttcta atctggggag
  ctatatcctc aggagaaaat 3661 tcattttaat cgctttggta
  taactctgga tgaaacacac atttaaaaaa aaatcaaaaa 3721
  cgaaataaga aaagagaatt aattgctcta gcaatgacta
  ataaatataa actttttaaa 3781 gg

44
In The Name of Allah (God) The Most Compassionate
The Most Merciful
Say (O Muhammad SAW to mankind). "If the sea were
ink for (writing) the Words of my Lord, surely,
the sea would be exhausted before the Words of my
Lord would be finished, even if we brought
(another sea) like it for its aid."
The Noble Quran (18 109)
45
The human body is created in a process of assembly
46
The word that Allah (God) Almighty bestowed upon
Mary peace be upon Her

• The Word that became Jesus peace be upon Him
• Is the information containing the characteristics
  of Jesus peace be upon Him with respects to
• The sequence of the amino acids to be assembled
  and their number
• The color of the eyes, hair, skin, etc. of Jesus
  peace be upon Him.

47
Stages involved in the creation of Jesus peace be
upon Him
Stages involved in the creation of Adam peace be
upon Him
Allah (God) Almighty created Him from the Soil,
which indicates that the components comprising
the physical body of Adam peace be upon Him are
to be found in the soil
Since Allah (God) Almighty states that He created
Jesus peace be upon Him exactly like Adam. Thus
the components comprising the body of Jesus peace
be upon Him should be found in the Soil.
Then Allah (God) Almighty said to Jesus peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Jesus peace be upon him
Then Allah (God) Almighty said to Adam peace be
upon Him Be and He was. This means that Allah
(God) Almighty dictated a word that became the
physical body of Adam peace be upon him
Then Allah (God) Almighty integrated from His
spirit into the physical created body of Jesus
peace be upon Him
Then Allah (God) Almighty integrated from His
spirit into the physical created body of Adam
peace be upon Him
48
How is Jesus PBUH and Adam PBUH A Spirit from
Allah (God) Almighty?

• As viewed from a scientific point of view

49
What is the function of the soul?

• The body of Adam peace be upon Him without the
  soul could not walk, think, etc. (i.e. could not
  function)
• Thus it can be deduced that the soul is needed to
  stimulate neural nodes in the brain to initiate
  and maintain function
• The soul is an energy field which is integrated
  in the physical body of a human that causes
  function by stimulating neural pathways in the
  brain

50
The Physical Body of a Human
51
Tortora and Grabowski, 1996
The energy field within the human body
???? ?????? ?????? ?? ????? ???? ???????? ?? ????
??? ?????
The Human Body
52
In the Name of Allah (God) Almighty The Most
Gracious The Most Merciful
Integrating a soul into the physical body of Adam
peace be upon Him
And (remember) when your Lord said to the angels
"I am going to create a man (Adam) from sounding
clay of altered black smooth mud "So, when I
have fashioned him completely and breathed into
him (Adam) the soul which I created for him, then
fall (you) down prostrating yourselves unto him."
The Noble Quran (15 28-29)
Integrating a soul into the physical body of
Jesus peace be upon Him
And (remember) she who guarded her chastity
Virgin Maryam (Mary), Allah (God) blew into her
from His soul, and Allah (God) has made her and
her son 'Iesa (Jesus) a sign for Al-'Alamin
(the mankind and jinns).
The Noble Quran (21 91)
53
The birth of Jesus peace be upon him

• Step 1 a word from Allah all Mighty, in this
  word there is the following
• Characteristics of Jesus (pbuh) (skin, eyes, hair
  colour, etc.)
• Step 2 Shaping of Jesus (pbuh) in the womb done
  by an angle (as it happens to every human)

54
The Creation of Jesus Peace be Upon Him

• From A Christian Perspective

55
The birth of Jesus peace be upon him in the Bible

• Luke 1 (NIV)34"How will this be," Mary asked the
  angel, "since I am a virgin?" 35The angel
  answered, "The Holy Spirit will come upon you,
  and the power of the Most High will overshadow
  you. So the holy one to be born will be called
  the Son of God.

56
The Description of Jesus peace be upon Him in the
Bible

• John 316 (King James Version)For God so loved
  the world, that he gave his only begotten Son,
  that whosoever believeth in him should not
  perish, but have everlasting life.

57
In The Name of Allah (God) The Most Compassionate
The Most Merciful
And they say "The Most Beneficent (Allah (God))
has begotten a son (or offspring or children) as
the Jews say 'Uzair (Ezra) is the son of Allah
(God), and the Christians say that He has
begotten a son 'Iesa (Jesus), and the pagan
Arabs say that He has begotten daughters (angels,
etc.). Indeed you have brought forth (said) a
terrible evil thing. Whereby the heavens are
almost torn, and the earth is split asunder, and
the mountains fall in ruins, That they ascribe a
son to the Most Beneficent (Allah (God)). But it
is not suitable for (the Majesty of) the Most
Beneficent (Allah (God)) that He should beget a
son (or offspring or children). There is none
in the heavens and the earth but comes unto the
Most Beneficent (Allah (God)) as a slave.
The Noble Quran (19 88-93)
58
In The Name of Allah (God) The Most Compassionate
The Most Merciful
Allah (God) sends down the Quran that is healing
and mercy to those who believe and it increases
the wrong-doers nothing but loss
The Noble Quran (17 82)
59
Dr. Zaid Kasim Ghazzawi E-mail
zaidquran_at_yahoo.com Website www.quran-miracle.c
om